Pregnancy influences the selection of appropriate reference genes in mouse tissue: Determination of appropriate reference genes for quantitative reverse transcription PCR studies in tissues from the female mouse reproductive axis
This study examined the expression stability of a panel of twelve reference genes in tissues from the female mouse reproductive axis and the uterus. Gene expression studies were carried out using reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). cDNA was synthesised from RNA extracted from hypothalami, pituitaries, ovaries and uteri of female mice at ages representing weaning, puberty and adulthood as well as pregnancy (13 ± 1 days post-coitus) (n = a minimum of 3 at each age and at pregnancy). The reference genes examined included 18s, Actb, Atp5b, B2m, Canx, Cyc1, Eif4a2, Gapdh, Rpl13a, Sdha,...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Nasrin N A Berruien Joanne F Murray Caroline L Smith Source Type: research

Revealing new therapeutic opportunities in hypertension through network-driven integrative genetic analysis and drug target prediction approach
Gene. 2021 Jul 19:145856. doi: 10.1016/j.gene.2021.145856. Online ahead of print.ABSTRACTEpidemiological studies have established that untreated hypertension (HTN) is a major independent risk factor for developing cardiovascular diseases (CVD), stroke, renal failure, and other conditions. Several important studies have been published to prevent and manage HTN; however, antihypertensive agents' optimal choice remains controversial. Therefore, the present study is undertaken to update our knowledge in the primary treatment of HTN, specifically in the setting of other three important diseases. MicroRNAs (miRNAs) are remarkabl...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Kavita Sharma Prithvi Singh Md Amjad Beg Ravins Dohare Fareeda Athar Mansoor Ali Syed Source Type: research

Novel cross-regulation interactions between dlx genes in larval zebrafish
Gene. 2021 Jul 19:145848. doi: 10.1016/j.gene.2021.145848. Online ahead of print.ABSTRACTThe homeodomain-containing transcription factors dlx1a, dlx2a, dlx5a and dlx6a are expressed in the zebrafish brain in overlapping patterns and are important in vertebrate development. Previous work in mice have suggested the overlapping expression pattern is in part due to cross-regulatory interactions among the aforementioned dlx genes. However, the extent of these interactions and whether they are conserved among vertebrates remains to be determined. Through whole-mount in situ hybridization in zebrafish dlx mutants produced by CRIS...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Emily P Y Yu Sofia Perin Vishal Saxena Marc Ekker Source Type: research

Pregnancy influences the selection of appropriate reference genes in mouse tissue: Determination of appropriate reference genes for quantitative reverse transcription PCR studies in tissues from the female mouse reproductive axis
This study examined the expression stability of a panel of twelve reference genes in tissues from the female mouse reproductive axis and the uterus. Gene expression studies were carried out using reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). cDNA was synthesised from RNA extracted from hypothalami, pituitaries, ovaries and uteri of female mice at ages representing weaning, puberty and adulthood as well as pregnancy (13 ± 1 days post-coitus) (n = a minimum of 3 at each age and at pregnancy). The reference genes examined included 18s, Actb, Atp5b, B2m, Canx, Cyc1, Eif4a2, Gapdh, Rpl13a, Sdha,...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Nasrin N A Berruien Joanne F Murray Caroline L Smith Source Type: research

Revealing new therapeutic opportunities in hypertension through network-driven integrative genetic analysis and drug target prediction approach
Gene. 2021 Jul 19:145856. doi: 10.1016/j.gene.2021.145856. Online ahead of print.ABSTRACTEpidemiological studies have established that untreated hypertension (HTN) is a major independent risk factor for developing cardiovascular diseases (CVD), stroke, renal failure, and other conditions. Several important studies have been published to prevent and manage HTN; however, antihypertensive agents' optimal choice remains controversial. Therefore, the present study is undertaken to update our knowledge in the primary treatment of HTN, specifically in the setting of other three important diseases. MicroRNAs (miRNAs) are remarkabl...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Kavita Sharma Prithvi Singh Md Amjad Beg Ravins Dohare Fareeda Athar Mansoor Ali Syed Source Type: research

Novel cross-regulation interactions between dlx genes in larval zebrafish
Gene. 2021 Jul 19:145848. doi: 10.1016/j.gene.2021.145848. Online ahead of print.ABSTRACTThe homeodomain-containing transcription factors dlx1a, dlx2a, dlx5a and dlx6a are expressed in the zebrafish brain in overlapping patterns and are important in vertebrate development. Previous work in mice have suggested the overlapping expression pattern is in part due to cross-regulatory interactions among the aforementioned dlx genes. However, the extent of these interactions and whether they are conserved among vertebrates remains to be determined. Through whole-mount in situ hybridization in zebrafish dlx mutants produced by CRIS...
Source: Gene - July 22, 2021 Category: Genetics & Stem Cells Authors: Emily P Y Yu Sofia Perin Vishal Saxena Marc Ekker Source Type: research

FGGY Carbohydrate Kinase Domain Containing is Expressed and Alternatively Spiced in Skeletal Muscle and Attenuates MAP Kinase and Akt Signaling
Gene. 2021 Jul 16:145836. doi: 10.1016/j.gene.2021.145836. Online ahead of print.ABSTRACTSkeletal muscle atrophy can result from a range of physiological conditions, including denervation, immobilization, hindlimb unweighting, and aging. To better characterize the molecular genetic events of atrophy, a microarray analysis revealed that FGGY carbohydrate kinase domain containing (Fggy) is expressed in skeletal muscle and is induced in response to denervation. Bioinformatic analysis of the Fggy gene locus revealed two validated isoforms with alternative transcription initiation sites that we have designated Fggy-L-552 and Fg...
Source: Gene - July 19, 2021 Category: Genetics & Stem Cells Authors: Anastasia L Smith Erisa Gjoka Mahnoor Izhar Karla J Novo Brittany C Mason Annabella De Las Casas David S Waddell Source Type: research

FGGY Carbohydrate Kinase Domain Containing is Expressed and Alternatively Spiced in Skeletal Muscle and Attenuates MAP Kinase and Akt Signaling
Gene. 2021 Jul 16:145836. doi: 10.1016/j.gene.2021.145836. Online ahead of print.ABSTRACTSkeletal muscle atrophy can result from a range of physiological conditions, including denervation, immobilization, hindlimb unweighting, and aging. To better characterize the molecular genetic events of atrophy, a microarray analysis revealed that FGGY carbohydrate kinase domain containing (Fggy) is expressed in skeletal muscle and is induced in response to denervation. Bioinformatic analysis of the Fggy gene locus revealed two validated isoforms with alternative transcription initiation sites that we have designated Fggy-L-552 and Fg...
Source: Gene - July 19, 2021 Category: Genetics & Stem Cells Authors: Anastasia L Smith Erisa Gjoka Mahnoor Izhar Karla J Novo Brittany C Mason Annabella De Las Casas David S Waddell Source Type: research

FGGY Carbohydrate Kinase Domain Containing is Expressed and Alternatively Spiced in Skeletal Muscle and Attenuates MAP Kinase and Akt Signaling
Gene. 2021 Jul 16:145836. doi: 10.1016/j.gene.2021.145836. Online ahead of print.ABSTRACTSkeletal muscle atrophy can result from a range of physiological conditions, including denervation, immobilization, hindlimb unweighting, and aging. To better characterize the molecular genetic events of atrophy, a microarray analysis revealed that FGGY carbohydrate kinase domain containing (Fggy) is expressed in skeletal muscle and is induced in response to denervation. Bioinformatic analysis of the Fggy gene locus revealed two validated isoforms with alternative transcription initiation sites that we have designated Fggy-L-552 and Fg...
Source: Gene - July 19, 2021 Category: Genetics & Stem Cells Authors: Anastasia L Smith Erisa Gjoka Mahnoor Izhar Karla J Novo Brittany C Mason Annabella De Las Casas David S Waddell Source Type: research

Differences in DNA methylation between slow and fast muscle in Takifugu rubripes
Gene. 2021 Jul 15:145853. doi: 10.1016/j.gene.2021.145853. Online ahead of print.ABSTRACTFish skeletal muscle is comprised of fast muscle (FM) and slow muscle (SM), which constitutes 60% of total the body mass. Fish skeletal muscle can affect fish swimming activity, which is important for aquaculture due to its growth-potentiating effects. DNA methylation can influence gene expression level. We previously identified multiple differentially expressed genes (DEGs) between FM and SM in Takifugu rubripes. However, it is unknown if the expression levels of these DEGs are influenced by DNA methylation. In the present study, we u...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Haoze Wang Jun Cui Xuemei Qiu Xiuli Wang Source Type: research

Genome skims analysis of betel palms (Areca spp., Arecaceae) and development of a profiling method to assess their plastome diversity
Gene. 2021 Jul 15:145845. doi: 10.1016/j.gene.2021.145845. Online ahead of print.ABSTRACTThe betel nut (Areca catechu L., Arecaceae) is a monoecious cultivated palm tree that is widespread in tropical regions. It is mainly cultivated for producing areca nuts, from which seeds are extracted and chewed by local populations principally in the Indo-Pacific region. Seeds contain alkaloids which are central nervous system stimulants and are highly addictive. Wild relatives of the betel nut are distributed in South Asia and Australasia, with ca. 40-50 Areca species currently recognized. The geographic origin(s) of the betel nut a...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Pauline Raimondeau Sophie Manzi Nicolas Brucato Christopher Kinipi Matthew Leavesley Fran çois-Xavier Ricaut Guillaume Besnard Source Type: research

Authors' reply to Jayaraj et al. 's Letter to the Editor re: MIR196A2 rs11614913 contributes to susceptibility to colorectal cancer in Iranian population: A multi-center case-control study and meta-analysis
Gene. 2021 Jul 15:145849. doi: 10.1016/j.gene.2021.145849. Online ahead of print.NO ABSTRACTPMID:34274466 | DOI:10.1016/j.gene.2021.145849 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Monir Sadat Haerian Batoul Sadat Haerian Saadat Molanaei Farid Kosari Shahram Sabeti Farahnaz Bidari-Zerehpoosh Ebrahim Abdolali Source Type: research

Genome-wide identification and expression analysis of U-box gene family in wild emmer wheat (Triticum turgidum L. ssp. dicoccoides)
In this study, 82 U-box genes were identified in wild emmer wheat (TdPUBs) through a genome-search method. Phylogenetic analysis classified them into seven groups and the genes belonging to the same group shared the similar exon-intron structure, motif organization and cis-element compositions. Synteny analysis of the U-box genes between different species revealed that segmental duplication and polyploidization mainly contributed to the expansion of TdPUBs. Furthermore, the genetic variations of U-box were investigated in wild emmer, domesticated emmer and durum wheat. Results showed that significant genetic bottleneck has...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Guang Yang Gao Ying Zhenyu Wang Wenqiu Pan Bin Linghu Yan Pan Weining Song Licao Cui Xiaojun Nie Source Type: research

HA of H1N1 enhanced the expression of ICAM-1 and IL-6 in HUVECs and pathological injury in the lungs in mice
Gene. 2021 Jul 15:145854. doi: 10.1016/j.gene.2021.145854. Online ahead of print.ABSTRACTBoth COVID-19 and influenza are viral respiratory tract infections and the epidemics of viral respiratory tract infections remain highly prevalent with lethal consequences in susceptible individuals. Expression of ICAM-1 on vascular endothelium recruits leukocytes which initiates inflammation. IL-6 induces ICAM-1. Both ICAM-1 and IL-6 can be enhanced in influenza virus infection and COVID-19 patients. Besides initiation of virus entry host cells, whether HA alone, instead of whole virus, of influenza has the effects on expression of IC...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Ming-Zhen Zhao Xiang Guo Bo Sun Xiao-Fang Sun Gui-Fen Pang Lin-Ying Yang Xing Zhao Li-Xin Sun Qing Zhang Source Type: research

Transcriptomic landscape of persistent diarrhoea in rhesus macaques and comparison with humans and mouse models with inflammatory bowel disease
In conclusion, our results showed that there were significant immune differences between persistent diarrhoeal rhesus macaques and healthy macaques, which was similar to the expression differences in IBD patients and mouse models.PMID:34274469 | DOI:10.1016/j.gene.2021.145837 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Jiao Wang Mingyi Lv Lewei He Xinqi Wang Yue Lan Jieyun Chen Minghui Chen Chunhui Zhang Ruixiang Tang Dan Zhou Xiaoyang Deng Jing Li Tao Guo Megan Price Bisong Yue Zhenxin Fan Source Type: research

Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19
The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST®>> blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Sabrina Ferreira de Jesus La ércio Ives Santos Jo ão Felício Rodrigues Neto Thallyta Maria Vieira Jo ão Batista Mendes Marcos Flavio Silveira Vasconcelos D'angelo Andr é Luiz Sena Guimaraes Source Type: research

NANOG gene suppression and replacement of let-7 modulate the stemness, invasion, and apoptosis in breast cancer
In conclusion, these findings showed that a combination of Let-7a miRNA mimic and Nanog siRNA could be exploited as a new treatment to enhance tumoricidal strategy treatment and to improve the cancer therapy outcome. In this study, we showed that the using a combination of Let-7a increase and NANOG inhibition could possibly tumoricidal outcome.PMID:34274471 | DOI:10.1016/j.gene.2021.145844 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Zeynab Aliyari Serej Ayyub Ebrahimi Tohid Kazemi Souzan Najafi Mohammad Amini Parastou Nastarin Elham Baghbani Behzad Baradaran Source Type: research

MIR17HG genetic variations affect the susceptibility of IgA nephropathy in Chinese Han people
This study aimed to explore the association between MIR17HG polymorphisms and IgAN susceptibility.METHODS: Six single nucleotide polymorphisms (SNPs) of MIR17HG were genotyped in 417 patients with IgAN and 424 healthy controls. The association analysis was conducted by logistic regression adjusted for age and gender in multiple genetic models and different subgroups.RESULTS: Our results revealed that rs72640334 and rs1428 increased the susceptibility to IgAN in total populations (p 35 years (p
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Langtao Hu Yin Zhang Kai Yang Xing Mai Jiali Wei Chunyang Ma Source Type: research

Insulin treatment to type 1 male diabetic rats protects fertility by avoiding testicular apoptosis and cell cycle arrest
Gene. 2021 Jul 15:145847. doi: 10.1016/j.gene.2021.145847. Online ahead of print.ABSTRACTBACKGROUND: Uncontrolled type 1 diabetes mellitus (T1D) impairs reproductive potential of males. Insulin treatment restores metabolic parameters but it is unclear how it protects male reproductive health. Herein, we hypothesized that insulin treatment to T1D rats protects testicular physiology by mediating mechanisms associated with apoptosis and cell cycle.METHODS: Mature male Wistar rats (n=24) were divided into 3 groups: control, T1D-induced (received 40 mg kg-1 streptozotocin) and insulin-treated T1D (Ins T1D; received 40 mg kg-1 s...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Aram Minas Hatef Talebi Morteza Taravat Ray Mohammad Yari Eisalou Marco G Aleves Mazdak Razi Source Type: research

Identification of Genomic imbalances (CNVs as well as LOH) in Sertoli Cell Only Syndrome cases through Cytoscan Microarray
This study should be extended for larger cohort of patients.PMID:34274474 | DOI:10.1016/j.gene.2021.145851 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: A Sharma M Jain A Halder S Kaushal Source Type: research

Association of Human forkhead box protein 3 (FOXP3) gene polymorphisms with idiopathic recurrent pregnancy loss among Kazakhstani women
Gene. 2021 Jul 15:145835. doi: 10.1016/j.gene.2021.145835. Online ahead of print.ABSTRACTBACKGROUND: Recurrent pregnancy loss (RPL) is major pregnancy complication, with poorly defined cause.Forkhead Box P3 (FOXP3) is a transcription factor that supports Treg activation and development and attenuates immune responses. As FOXP3 production is genetically determined, we tested the association of FOXP3 gene variants with RPL.METHODS: A retrospective case-control study, performed between April 2019 and February 2020. Study subjects comprised 62 RPL cases and 60 control women. Genotyping of the four FOXP3 variants rs2294021 (T&g...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Meruyert Abdulkassimova Perizat Kanabekova Zhansaya Bauyrzhanova Talshyn Ukybassova Lyazzat Kaldygulova Balkenzhe Imankulova Gulzhanat Aimagambetova Wassim Y Almawi Source Type: research

Association of FOXO3a gene polymorphisms and ankylosing spondylitis susceptibility in Eastern Chinese Han population
Gene. 2021 Jul 15:145832. doi: 10.1016/j.gene.2021.145832. Online ahead of print.ABSTRACTOBJECTIVE: To investigate the association of FOXO3a polymorphisms and ankylosing spondylitis (AS) susceptibility in Eastern Chinese Han population.METHODS: FOXO3a polymorphisms rs12206094, rs12212067, rs2253310, rs3800232, and rs4946933 were genotyped in 650 AS patients and 646 controls by the improved Multiple Ligase Detection Reaction.RESULTS: The distribution of genotype in rs12212067 polymorphism was significantly different between AS patients and controls (P = 0.020), especially in male population (P = 0.009). There was significan...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Shanshan Xu Zhipeng Pan Li Huang Yuting Chen Huimin Xie Feier Wang Tingting Zhou Lingxiang Yu Jiangpiang Kong Shengqian Xu Faming Pan Source Type: research

The complete mitochondrial genome of Choroterpes (Euthralus) yixingensis (Ephemeroptera: Leptophlebiidae) and its mitochondrial protein-coding gene expression under imidacloprid stress
Gene. 2021 Jul 15:145833. doi: 10.1016/j.gene.2021.145833. Online ahead of print.ABSTRACTAs one of the most common benthic invertebrates in freshwater, mayflies are very sensitive to changes in water quality and have high requirements for the water environment to allow their nymphs to successfully live and grow. Neonicotinoids, such as imidacloprid, can enter fresh water and pollute the aquatic environment. The present study had two goals: (1) investigate imidacloprid effects on mayfly larvae Choroterpes (Euthralus) yixingensis, and (2) contribute to the phylogenetic status of Ephemeroptera that has always been controversi...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Jia-Yin Guan Zi-Yi Zhang Yu-Rou Cao Xiao-Dong Xu Kenneth B Storey Dan-Na Yu Jia-Yong Zhang Source Type: research

No association between the SARS-CoV-2 variants and mortality rates in the Eastern Mediterranean Region
Gene. 2021 Jul 15:145843. doi: 10.1016/j.gene.2021.145843. Online ahead of print.ABSTRACTAs the novel coronavirus SARS-CoV-2 continues to spread in all countries, there is a growing interest in monitoring and understanding the impact of emerging strains on virus transmission and disease severity. Here, we analyzed SARS-CoV-2 genomic sequences reported in the Eastern Mediterranean Region (EMR) countries, as of 1 January 2021. The majority (∼75%) of these sequences originated from three out of 22 EMR countries, and 65.8% of all sequences belonged to GISAID clades GR, GH, G and GV. A delay ranging between 30-150 days from...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Saad Omais Samer Kharroubi Hassan Zaraket Source Type: research

Mitogen-induced transcriptional programming in human fibroblasts
Gene. 2021 Jul 15:145842. doi: 10.1016/j.gene.2021.145842. Online ahead of print.ABSTRACTTreatment of serum-starved quiescent human cells with fetal bovine serum (FBS), epidermal growth factor (EGF), or the phorbol ester (12-O-tetradecanoylphorbol-13-acetate, TPA) activates the RAS-MAPK pathway which initiates a transcriptional program which drives cells toward proliferation. Stimulation of the RAS-MAPK pathway activates mitogen- and stress-activated kinases (MSK) 1 and 2, which phosphorylate histone H3 at S10 (H3S10ph) or S28 (H3S28ph) (nucleosomal response) located at the regulatory regions of immediate-early genes, sett...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Kiran L Sharma Shuo Jia Tasnim H Beacon Ifeoluwa Adewumi Camila L ópez Pingzhao Hu Wayne Xu James R Davie Source Type: research

The porcine cerebellin gene family
In this study, I present a molecular characterization of the four porcine CBLN genes. Experimental data and in silico analyses collectively describes the gene structure, chromosomal localization, and expression of CBLN1-4. Two cDNAs encoding the cerebellins CBLN1 and CBLN3 were RT-PCR cloned and sequenced. The nucleotide sequence of the CBLN1 clone contains an open reading frame of 582 nucleotides and encodes a protein of 193 amino acids. The deduced amino acid of the porcine CBLN1 protein was 99% identical to both mouse CBLN1 and to human CBLN1. The deduced CBLN1 protein contains a putative signal sequence of 21 residues,...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Knud Larsen Source Type: research

When good mitochondria go bad: Cyto-nuclear discordance in landfowl (Aves: Galliformes)
Gene. 2021 Jul 15:145841. doi: 10.1016/j.gene.2021.145841. Online ahead of print.ABSTRACTMitochondrial sequences were among the first molecular data collected for phylogenetic studies and they plentiful in DNA sequence archives. However, the future value of mitogenomic data in phylogenetics is uncertain, because its phylogenetic signal sometimes conflicts with that of the nuclear genome. A thorough understanding of the causes and prevalence of cyto-nuclear discordance would aid in reconciling different results owing to sequence data type, and provide a framework for interpreting megaphylogenies when taxa which lack substan...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Rebecca T Kimball Marissa Guido Peter A Hosner Edward L Braun Source Type: research

Identification and expression analysis of the β-defensin genes in the goat small intestine
In this study, we identified a total of 50 β-defensins from the goat genome, including 48 functional genes and 2 pseudogenes. Cross-species genomic and evolutionary analyses showed that all of the β-defensins in goat chromosomes 8, 13 and 23 present one-to-one orthologous relationships to their sheep and cattle counterparts, whereas some β-defensin genes in goat chromosome 27 are goat-specific. Moreover, we observed that some duplicated genes in goat chromosome 27 may be derived from gene copy number variation, and the annotation of sheep and cattle β-defensins appears to be incomplete in the genome. Im...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Long Zhang Haihong Xiao Jian Huang Linghua Ouyang Siming Li Yanqiang Tang Source Type: research

Polymorphisms in METTL3 gene and hepatoblastoma risk in Chinese children: a seven-center case-control study
Gene. 2021 Jul 15:145834. doi: 10.1016/j.gene.2021.145834. Online ahead of print.ABSTRACTHepatoblastoma is the most common malignant liver cancer in childhood, yet its etiology remains unclear. As an m6A methylation modifier, methyltransferase like 3 (METTL3) has an active methyltransferase domain that functionally participates in various tumor occurrence and development. However, little is known about how METTL3 polymorphisms affect the occurrence of hepatoblastoma. Here, we attempted to investigate the associations between METTL3 gene polymorphisms and hepatoblastoma risk in a seven-center case-control study. We genotype...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Huitong Chen Fei Duan Mi Wang Jinhong Zhu Jiao Zhang Jiwen Cheng Li Li Suhong Li Yong Li Zhonghua Yang Huimin Xia Huizhong Niu Jing He Source Type: research

Genome-Wide Expression Analysis Reveal Host Genes Involved in Immediate-Early Infections of Different Sheeppox Virus Strains
This study explored the transcriptome of lamb testis cells infected with sheeppox virus (SPPV) wild strain (WS) and vaccine strain (VS) at an immediate-early time. Most of the Differentially expressed genes (DEGs) and differentially expressed highly connected (DEHC) gene network were found to be involved in SPPVVS infection compared to SPPV-WS. Further the signaling pathways were mostly involved in SPPV-VS infection than SPPV-WS. The Pox virus modulates the expression of several important host proteins such as CD40, FAS, ITGβ1, ITGα1, Pak1, Pak2, CD14, ILK leading to viral attachment and entry; immune-related DE...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Joyshikh Sonowal Chhabi Lal Patel Ravi Kumar Gandham Basavaraj Sajjanar Raja Ishaq Nabi Khan Manas Ranjan Praharaj Waseem Akram Malla Dipak Kumar Kapil Dev N Barkathullah Krishna Bharali Amitesh Dubey D Lalita Insha Zafir B P Mishra Bina Mishra Source Type: research

Novel DNA methylation markers of PRRSV-specific antibodies and their intergenerational transmission from pregnant sows to piglets
Gene. 2021 Jul 15:145831. doi: 10.1016/j.gene.2021.145831. Online ahead of print.ABSTRACTThe main strategy for preventing porcine reproductive and respiratory syndrome (PRRS) is vaccination. However, current commercial porcine reproductive and respiratory syndrome virus (PRRSV) vaccines have limited effectiveness and may even cause infections in pigs. The identification of stable molecular markers associated with immune responses to PRRSV vaccination in pigs provides a new approach for PRRS prevention. DNA methylation, the most stable epigenetic molecular marker related to PRRSV vaccination, has not been investigated. In t...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Fengxia Zhang Siqian Chen Ting Yang Hong Ao Liwei Zhai Qianjun Li Kai Xing Yibing Liu Huatao Liu Ying Yu Chuduan Wang Source Type: research

Differences in DNA methylation between slow and fast muscle in Takifugu rubripes
Gene. 2021 Jul 15:145853. doi: 10.1016/j.gene.2021.145853. Online ahead of print.ABSTRACTFish skeletal muscle is comprised of fast muscle (FM) and slow muscle (SM), which constitutes 60% of total the body mass. Fish skeletal muscle can affect fish swimming activity, which is important for aquaculture due to its growth-potentiating effects. DNA methylation can influence gene expression level. We previously identified multiple differentially expressed genes (DEGs) between FM and SM in Takifugu rubripes. However, it is unknown if the expression levels of these DEGs are influenced by DNA methylation. In the present study, we u...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Haoze Wang Jun Cui Xuemei Qiu Xiuli Wang Source Type: research

Genome skims analysis of betel palms (Areca spp., Arecaceae) and development of a profiling method to assess their plastome diversity
Gene. 2021 Jul 15:145845. doi: 10.1016/j.gene.2021.145845. Online ahead of print.ABSTRACTThe betel nut (Areca catechu L., Arecaceae) is a monoecious cultivated palm tree that is widespread in tropical regions. It is mainly cultivated for producing areca nuts, from which seeds are extracted and chewed by local populations principally in the Indo-Pacific region. Seeds contain alkaloids which are central nervous system stimulants and are highly addictive. Wild relatives of the betel nut are distributed in South Asia and Australasia, with ca. 40-50 Areca species currently recognized. The geographic origin(s) of the betel nut a...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Pauline Raimondeau Sophie Manzi Nicolas Brucato Christopher Kinipi Matthew Leavesley Fran çois-Xavier Ricaut Guillaume Besnard Source Type: research

Authors' reply to Jayaraj et al. 's Letter to the Editor re: MIR196A2 rs11614913 contributes to susceptibility to colorectal cancer in Iranian population: A multi-center case-control study and meta-analysis
Gene. 2021 Jul 15:145849. doi: 10.1016/j.gene.2021.145849. Online ahead of print.NO ABSTRACTPMID:34274466 | DOI:10.1016/j.gene.2021.145849 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Monir Sadat Haerian Batoul Sadat Haerian Saadat Molanaei Farid Kosari Shahram Sabeti Farahnaz Bidari-Zerehpoosh Ebrahim Abdolali Source Type: research

Genome-wide identification and expression analysis of U-box gene family in wild emmer wheat (Triticum turgidum L. ssp. dicoccoides)
In this study, 82 U-box genes were identified in wild emmer wheat (TdPUBs) through a genome-search method. Phylogenetic analysis classified them into seven groups and the genes belonging to the same group shared the similar exon-intron structure, motif organization and cis-element compositions. Synteny analysis of the U-box genes between different species revealed that segmental duplication and polyploidization mainly contributed to the expansion of TdPUBs. Furthermore, the genetic variations of U-box were investigated in wild emmer, domesticated emmer and durum wheat. Results showed that significant genetic bottleneck has...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Guang Yang Gao Ying Zhenyu Wang Wenqiu Pan Bin Linghu Yan Pan Weining Song Licao Cui Xiaojun Nie Source Type: research

HA of H1N1 enhanced the expression of ICAM-1 and IL-6 in HUVECs and pathological injury in the lungs in mice
Gene. 2021 Jul 15:145854. doi: 10.1016/j.gene.2021.145854. Online ahead of print.ABSTRACTBoth COVID-19 and influenza are viral respiratory tract infections and the epidemics of viral respiratory tract infections remain highly prevalent with lethal consequences in susceptible individuals. Expression of ICAM-1 on vascular endothelium recruits leukocytes which initiates inflammation. IL-6 induces ICAM-1. Both ICAM-1 and IL-6 can be enhanced in influenza virus infection and COVID-19 patients. Besides initiation of virus entry host cells, whether HA alone, instead of whole virus, of influenza has the effects on expression of IC...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Ming-Zhen Zhao Xiang Guo Bo Sun Xiao-Fang Sun Gui-Fen Pang Lin-Ying Yang Xing Zhao Li-Xin Sun Qing Zhang Source Type: research

Transcriptomic landscape of persistent diarrhoea in rhesus macaques and comparison with humans and mouse models with inflammatory bowel disease
In conclusion, our results showed that there were significant immune differences between persistent diarrhoeal rhesus macaques and healthy macaques, which was similar to the expression differences in IBD patients and mouse models.PMID:34274469 | DOI:10.1016/j.gene.2021.145837 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Jiao Wang Mingyi Lv Lewei He Xinqi Wang Yue Lan Jieyun Chen Minghui Chen Chunhui Zhang Ruixiang Tang Dan Zhou Xiaoyang Deng Jing Li Tao Guo Megan Price Bisong Yue Zhenxin Fan Source Type: research

Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19
The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST®>> blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Sabrina Ferreira de Jesus La ércio Ives Santos Jo ão Felício Rodrigues Neto Thallyta Maria Vieira Jo ão Batista Mendes Marcos Flavio Silveira Vasconcelos D'angelo Andr é Luiz Sena Guimaraes Source Type: research

NANOG gene suppression and replacement of let-7 modulate the stemness, invasion, and apoptosis in breast cancer
In conclusion, these findings showed that a combination of Let-7a miRNA mimic and Nanog siRNA could be exploited as a new treatment to enhance tumoricidal strategy treatment and to improve the cancer therapy outcome. In this study, we showed that the using a combination of Let-7a increase and NANOG inhibition could possibly tumoricidal outcome.PMID:34274471 | DOI:10.1016/j.gene.2021.145844 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Zeynab Aliyari Serej Ayyub Ebrahimi Tohid Kazemi Souzan Najafi Mohammad Amini Parastou Nastarin Elham Baghbani Behzad Baradaran Source Type: research

MIR17HG genetic variations affect the susceptibility of IgA nephropathy in Chinese Han people
This study aimed to explore the association between MIR17HG polymorphisms and IgAN susceptibility.METHODS: Six single nucleotide polymorphisms (SNPs) of MIR17HG were genotyped in 417 patients with IgAN and 424 healthy controls. The association analysis was conducted by logistic regression adjusted for age and gender in multiple genetic models and different subgroups.RESULTS: Our results revealed that rs72640334 and rs1428 increased the susceptibility to IgAN in total populations (p 35 years (p
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Langtao Hu Yin Zhang Kai Yang Xing Mai Jiali Wei Chunyang Ma Source Type: research

Insulin treatment to type 1 male diabetic rats protects fertility by avoiding testicular apoptosis and cell cycle arrest
Gene. 2021 Jul 15:145847. doi: 10.1016/j.gene.2021.145847. Online ahead of print.ABSTRACTBACKGROUND: Uncontrolled type 1 diabetes mellitus (T1D) impairs reproductive potential of males. Insulin treatment restores metabolic parameters but it is unclear how it protects male reproductive health. Herein, we hypothesized that insulin treatment to T1D rats protects testicular physiology by mediating mechanisms associated with apoptosis and cell cycle.METHODS: Mature male Wistar rats (n=24) were divided into 3 groups: control, T1D-induced (received 40 mg kg-1 streptozotocin) and insulin-treated T1D (Ins T1D; received 40 mg kg-1 s...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Aram Minas Hatef Talebi Morteza Taravat Ray Mohammad Yari Eisalou Marco G Aleves Mazdak Razi Source Type: research

Identification of Genomic imbalances (CNVs as well as LOH) in Sertoli Cell Only Syndrome cases through Cytoscan Microarray
This study should be extended for larger cohort of patients.PMID:34274474 | DOI:10.1016/j.gene.2021.145851 (Source: Gene)
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: A Sharma M Jain A Halder S Kaushal Source Type: research

Association of Human forkhead box protein 3 (FOXP3) gene polymorphisms with idiopathic recurrent pregnancy loss among Kazakhstani women
Gene. 2021 Jul 15:145835. doi: 10.1016/j.gene.2021.145835. Online ahead of print.ABSTRACTBACKGROUND: Recurrent pregnancy loss (RPL) is major pregnancy complication, with poorly defined cause.Forkhead Box P3 (FOXP3) is a transcription factor that supports Treg activation and development and attenuates immune responses. As FOXP3 production is genetically determined, we tested the association of FOXP3 gene variants with RPL.METHODS: A retrospective case-control study, performed between April 2019 and February 2020. Study subjects comprised 62 RPL cases and 60 control women. Genotyping of the four FOXP3 variants rs2294021 (T&g...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Meruyert Abdulkassimova Perizat Kanabekova Zhansaya Bauyrzhanova Talshyn Ukybassova Lyazzat Kaldygulova Balkenzhe Imankulova Gulzhanat Aimagambetova Wassim Y Almawi Source Type: research

Association of FOXO3a gene polymorphisms and ankylosing spondylitis susceptibility in Eastern Chinese Han population
Gene. 2021 Jul 15:145832. doi: 10.1016/j.gene.2021.145832. Online ahead of print.ABSTRACTOBJECTIVE: To investigate the association of FOXO3a polymorphisms and ankylosing spondylitis (AS) susceptibility in Eastern Chinese Han population.METHODS: FOXO3a polymorphisms rs12206094, rs12212067, rs2253310, rs3800232, and rs4946933 were genotyped in 650 AS patients and 646 controls by the improved Multiple Ligase Detection Reaction.RESULTS: The distribution of genotype in rs12212067 polymorphism was significantly different between AS patients and controls (P = 0.020), especially in male population (P = 0.009). There was significan...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Shanshan Xu Zhipeng Pan Li Huang Yuting Chen Huimin Xie Feier Wang Tingting Zhou Lingxiang Yu Jiangpiang Kong Shengqian Xu Faming Pan Source Type: research

The complete mitochondrial genome of Choroterpes (Euthralus) yixingensis (Ephemeroptera: Leptophlebiidae) and its mitochondrial protein-coding gene expression under imidacloprid stress
Gene. 2021 Jul 15:145833. doi: 10.1016/j.gene.2021.145833. Online ahead of print.ABSTRACTAs one of the most common benthic invertebrates in freshwater, mayflies are very sensitive to changes in water quality and have high requirements for the water environment to allow their nymphs to successfully live and grow. Neonicotinoids, such as imidacloprid, can enter fresh water and pollute the aquatic environment. The present study had two goals: (1) investigate imidacloprid effects on mayfly larvae Choroterpes (Euthralus) yixingensis, and (2) contribute to the phylogenetic status of Ephemeroptera that has always been controversi...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Jia-Yin Guan Zi-Yi Zhang Yu-Rou Cao Xiao-Dong Xu Kenneth B Storey Dan-Na Yu Jia-Yong Zhang Source Type: research

No association between the SARS-CoV-2 variants and mortality rates in the Eastern Mediterranean Region
Gene. 2021 Jul 15:145843. doi: 10.1016/j.gene.2021.145843. Online ahead of print.ABSTRACTAs the novel coronavirus SARS-CoV-2 continues to spread in all countries, there is a growing interest in monitoring and understanding the impact of emerging strains on virus transmission and disease severity. Here, we analyzed SARS-CoV-2 genomic sequences reported in the Eastern Mediterranean Region (EMR) countries, as of 1 January 2021. The majority (∼75%) of these sequences originated from three out of 22 EMR countries, and 65.8% of all sequences belonged to GISAID clades GR, GH, G and GV. A delay ranging between 30-150 days from...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Saad Omais Samer Kharroubi Hassan Zaraket Source Type: research

Mitogen-induced transcriptional programming in human fibroblasts
Gene. 2021 Jul 15:145842. doi: 10.1016/j.gene.2021.145842. Online ahead of print.ABSTRACTTreatment of serum-starved quiescent human cells with fetal bovine serum (FBS), epidermal growth factor (EGF), or the phorbol ester (12-O-tetradecanoylphorbol-13-acetate, TPA) activates the RAS-MAPK pathway which initiates a transcriptional program which drives cells toward proliferation. Stimulation of the RAS-MAPK pathway activates mitogen- and stress-activated kinases (MSK) 1 and 2, which phosphorylate histone H3 at S10 (H3S10ph) or S28 (H3S28ph) (nucleosomal response) located at the regulatory regions of immediate-early genes, sett...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Kiran L Sharma Shuo Jia Tasnim H Beacon Ifeoluwa Adewumi Camila L ópez Pingzhao Hu Wayne Xu James R Davie Source Type: research

The porcine cerebellin gene family
In this study, I present a molecular characterization of the four porcine CBLN genes. Experimental data and in silico analyses collectively describes the gene structure, chromosomal localization, and expression of CBLN1-4. Two cDNAs encoding the cerebellins CBLN1 and CBLN3 were RT-PCR cloned and sequenced. The nucleotide sequence of the CBLN1 clone contains an open reading frame of 582 nucleotides and encodes a protein of 193 amino acids. The deduced amino acid of the porcine CBLN1 protein was 99% identical to both mouse CBLN1 and to human CBLN1. The deduced CBLN1 protein contains a putative signal sequence of 21 residues,...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Knud Larsen Source Type: research

When good mitochondria go bad: Cyto-nuclear discordance in landfowl (Aves: Galliformes)
Gene. 2021 Jul 15:145841. doi: 10.1016/j.gene.2021.145841. Online ahead of print.ABSTRACTMitochondrial sequences were among the first molecular data collected for phylogenetic studies and they plentiful in DNA sequence archives. However, the future value of mitogenomic data in phylogenetics is uncertain, because its phylogenetic signal sometimes conflicts with that of the nuclear genome. A thorough understanding of the causes and prevalence of cyto-nuclear discordance would aid in reconciling different results owing to sequence data type, and provide a framework for interpreting megaphylogenies when taxa which lack substan...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Rebecca T Kimball Marissa Guido Peter A Hosner Edward L Braun Source Type: research

Identification and expression analysis of the β-defensin genes in the goat small intestine
In this study, we identified a total of 50 β-defensins from the goat genome, including 48 functional genes and 2 pseudogenes. Cross-species genomic and evolutionary analyses showed that all of the β-defensins in goat chromosomes 8, 13 and 23 present one-to-one orthologous relationships to their sheep and cattle counterparts, whereas some β-defensin genes in goat chromosome 27 are goat-specific. Moreover, we observed that some duplicated genes in goat chromosome 27 may be derived from gene copy number variation, and the annotation of sheep and cattle β-defensins appears to be incomplete in the genome. Im...
Source: Gene - July 18, 2021 Category: Genetics & Stem Cells Authors: Long Zhang Haihong Xiao Jian Huang Linghua Ouyang Siming Li Yanqiang Tang Source Type: research