Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19
The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® >> blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.PMID:34274470 | DOI:10.1016/j.gene.2021.145839
Source: Gene - Category: Genetics & Stem Cells Authors: Sabrina Ferreira de Jesus La ércio Ives Santos Jo ão Felício Rodrigues Neto Thallyta Maria Vieira Jo ão Batista Mendes Marcos Flavio Silveira Vasconcelos D'angelo Andr é Luiz Sena Guimaraes Source Type: research
More News: Biotechnology | China Health | Coronavirus | COVID-19 | Genetics | Men | MERS | Respiratory Medicine | SARS | Study | Vaccines