• Filter By:
• Specialty
• Source
• Condition
• Cancer
• Infectious Disease
• Drug
• Training
• Management
• Procedure
• Therapy
• Vaccine
• Nutrition
• Country

Effect of Epac1 on pERK and VEGF Activation in Postoperative Persistent Pain in Rats
This study suggests that activation of the Epac1 signal might induce local postoperative recovery process, which could be an important mechanism by which to control postoperative chronic pain. Our data suggest that therapy targeted at decreasing Epac1 levels provides promise for the prevention and treatment of chronic postoperative pain.
Source: Journal of Molecular Neuroscience - June 9, 2016 Category: Neuroscience Source Type: research

MicroRNA-25 Negatively Regulates Cerebral Ischemia/Reperfusion Injury-Induced Cell Apoptosis Through Fas/FasL Pathway
Abstract MicroRNA-25 (miR-25) has been reported to be a major miRNA marker in neural cells and is strongly expressed in ischemic brain tissues. However, the precise mechanism and effect of miR-25 in cerebral ischemia/reperfusion (I/R) injury needs further investigations. In the present study, the oxygen-glucose deprivation (OGD) model was constructed in human SH-SY5Y and IMR-32 cells to mimic I/R injury and to evaluate the role of miR-25 in regulating OGD/reperfusion (OGDR)-induced cell apoptosis. We found that miR-25 was downregulated in the OGDR model. Overexpression of miR-25 via miRNA-mimics transfection remar...
Source: Journal of Molecular Neuroscience - January 14, 2016 Category: Neuroscience Source Type: research

TCTP Expression After Rat Spinal Cord Injury: Implications for Astrocyte Proliferation and Migration
Abstract Translationally controlled tumor protein (TCTP) is a ubiquitous and highly conserved protein which plays a role in cell proliferation and growth, apoptosis, and cell cycle regulation. However, its expression and function in spinal cord injury (SCI) are still unknown. Here, we demonstrated that expression of TCTP was dynamic changed after acute spinal cord injury. Our results showed that TCTP gradually increased, reached a peak at 3 day, and then declined to basal levels at 14 days after spinal cord injury. Upregulation of TCTP was accompanied with an increase in the levels of proliferation proteins such...
Source: Journal of Molecular Neuroscience - August 12, 2015 Category: Neuroscience Source Type: research

Death Receptor 6 and Caspase-6 Regulate Prion Peptide-Induced Axonal Degeneration in Rat Spinal Neurons
Abstract Axonal degeneration is a hallmark of many neurodegenerative disorders including transmissible spongiform encephalopathies (TSE). However, the full complement of axonal degeneration triggers is not fully understood. In an in vitro prion model, we observed that treatment of rat spinal neurons with the prion peptide, PrP106-126, activated death receptor 6 (DR6, also known as TNFRSF21), caspase-6, caspase-3, and induced axonal degeneration. Knockdown of DR6 by siRNA blocked caspase-6 and caspase-3 activation and axonal degeneration. We also found that cleaved caspase-3 is only enriched in cell bodies, but cl...
Source: Journal of Molecular Neuroscience - August 1, 2015 Category: Neuroscience Source Type: research

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure
This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The ...
Source: Journal of Molecular Neuroscience - July 8, 2015 Category: Neuroscience Source Type: research

Involvement of MeCP2 in Regulation of Myelin-Related Gene Expression in Cultured Rat Oligodendrocytes
Abstract Methyl CpG binding protein 2 (MeCP2) is a multifunctional protein which binds to methylated CpG, mutation of which cause a neurodevelopmental disorder, Rett syndrome. MeCP2 can function as both transcriptional activator and repressor of target gene. MeCP2 regulate gene expression in both neuron and glial cells in central nervous system (CNS). Oligodendrocytes, the myelinating cells of CNS, are required for normal functioning of neurons and are regulated by several transcription factors during their differentiation. In current study, we focused on the role of MeCP2 as transcription regulator of myelin gene...
Source: Journal of Molecular Neuroscience - July 4, 2015 Category: Neuroscience Source Type: research

Insulin-Like Growth Factor Binding Protein-2 Promotes Adhesion of Endothelial Progenitor Cells to Endothelial Cells via Integrin α5β1
Abstract The contribution of endothelial progenitor cells (EPCs) to new vessel formation has been studied in different physiological and pathological conditions for decades. As previously suggested, insulin-like growth factor binding protein-2 (IGFBP-2) may interact with integrins and promote cell migration. However, the role of IGFBP-2 in regulation of EPC functions remains largely unknown. In this present study, we found that overexpression of IGFBP-2 in human umbilical vein endothelial cells (HUVECs) promoted EPC-endothelial adhesion. Conversely, siRNA-mediated depletion of IGFBP-2 inhibited oxygen-glucose depr...
Source: Journal of Molecular Neuroscience - June 16, 2015 Category: Neuroscience Source Type: research

TCF4 Mediates the Maintenance of Neuropathic Pain Through Wnt/β-Catenin Signaling Following Peripheral Nerve Injury in Rats
Abstract Neuropathic pain is elicited after a serious disorder of the nervous system and is along with the neural damage. It is usually chronic and challenging to treat. Transcription factor 4 (TCF4) is a key transcription factor of Wnt signaling system. Recent studies have shown that TCF4 interacts with β-catenin in the Wnt signaling pathway and coactivates downstream target genes in diverse systems. However, it is not well elucidated in the pathogenesis of neuropathic pain. In the present study, we investigated the role of TCF4 in the maintenance of neuropathic pain after chronic constriction injury (CCI) in ra...
Source: Journal of Molecular Neuroscience - May 11, 2015 Category: Neuroscience Source Type: research

Wogonin Induced Mitochondrial Dysfunction and Endoplasmic Reticulum Stress in Human Malignant Neuroblastoma Cells Via IRE1α-Dependent Pathway
Abstract Wogonin, a flavonoid isolated from Scutellaria baicalensis Georgi, has been reported to exhibit a variety of biological effects including anti-cancer effects. It has a pro-apoptotic role in many cancer types. However, the molecular mechanisms of wogonin in treating neuroblastoma remain elusive. In the present study, two malignant neuroblastoma cell lines (SK-N-BE2 and IMR-32 cells) were treated with different doses of wogonin (0–150 μM). Wogonin showed significant cytotoxic effects in SK-N-BE2 and IMR-32 cells in a dose- and time-dependent manner. Treatment of SK-N-BE2 and IMR-32 cells with 75 μΜ w...
Source: Journal of Molecular Neuroscience - March 5, 2015 Category: Neuroscience Source Type: research

Caspase-8 Mediates Amyloid-β-induced Apoptosis in Differentiated PC12 Cells
This study suggests that targeted inhibition of caspase-8 may be a new therapeutic for preventing neuronal apoptosis and inhibiting the progression of AD.
Source: Journal of Molecular Neuroscience - February 3, 2015 Category: Neuroscience Source Type: research

Intrathecal siRNA Against GPNMB Attenuates Nociception in a Rat Model of Neuropathic Pain
Abstract Neuropathic pain is characterized by hyperalgesia, allodynia, and spontaneous pain. Recent studies have shown that glycoprotein nonmetastatic melanoma B (GPNMB) plays a pivotal role in neuronal survival and neuroprotection. However, the role of GPNMB in neuropathic pain remains unknown. The aim of the present study was to assess the role of GPNMB in neuropathic pain. In cultured spinal cord neurons, we used two small interfering RNAs (siRNAs) targeting the complementary DNA (cDNA) sequence of rat GPNMB that had potent inhibitory effects on GPNMB, and siRNA1-GPNMB was selected for further in vivo study as...
Source: Journal of Molecular Neuroscience - January 23, 2015 Category: Neuroscience Source Type: research

Involvement of Nrf2 in Development of Anxiety-Like Behavior by Linking Bcl2 to Oxidative Phosphorylation: Estimation in Rat Hippocampus, Amygdala, and Prefrontal Cortex
In this study, we evaluated whether silencing of Nrf2 plays a role in development of anxiety-related behavior. In this regard, we exerted small interfering RNA (siRNA) targeting Nrf2 in dorsal third ventricle and subsequently examined the effect of this silencing on anxiety-related behavior along with supposed molecular mechanisms. Therefore, we evaluated apoptotic markers and mitochondrial electron transport chain (ETC) activity in three brain regions: hippocampus, amygdala, and prefrontal cortex. Based on our result, Nrf2-silenced rats exhibited greater anxiety-like behavior compared to control group. Furthermore, Nrf2 s...
Source: Journal of Molecular Neuroscience - January 23, 2015 Category: Neuroscience Source Type: research

Nucleolin Promotes TGF-β Signaling Initiation via TGF-β Receptor I in Glioblastoma
In conclusion, nucleolin promotes and regulates the TGF-β pathway by interacting with TβR-I and is required for initiation and activation of TGF-β signaling. Thus, nucleolin could be a key factor in glioblastoma pathogenesis and considered a therapeutic target, which may also mediate more signaling pathways.
Source: Journal of Molecular Neuroscience - January 1, 2015 Category: Neuroscience Source Type: research

FRK Inhibits Migration and Invasion of Human Glioma Cells by Promoting N-cadherin/β-catenin Complex Formation
In this study, we found that FRK over-expression increased the protein level of N-cadherin, but not E-cadherin. Meanwhile, FRK over-expression promoted β-catenin translocation to the plasma membrane, where it formed complex with N-cadherin, while decreased β-catenin level in the nuclear fraction. In addition, down-regulation of N-cadherin by siRNA promoted the migration and invasion of glioma U251 and U87 cells and abolished the inhibitory effect of FRK on glioma cell migration and invasion. In summary, these results indicate that FRK inhibits migration and invasion of human glioma cells by promoting N-cadherin/β-catenin complex formation.
Source: Journal of Molecular Neuroscience - January 1, 2015 Category: Neuroscience Source Type: research

The Expression of CAP1 After Traumatic Brain Injury and Its Role in Astrocyte Proliferation
Abstract Adenylate cyclase-associated protein 1 (CAP1), a member of cyclase-associated proteins involved in the regulation of actin filaments, was recently reported to play a role in the pathology of sciatic nerves injury. However, the distribution and function of CAP1 in the central nervous system (CNS) remain unclear. To investigate whether CAP1 is involved in CNS injury and repair, we used an acute traumatic brain injury (TBI) model in adult rats. Western blot analysis and immunohistochemistry showed a significant upregulation of CAP1 in ipsilateral peritrauma cortex compared with the contralateral and sham-op...
Source: Journal of Molecular Neuroscience - December 1, 2014 Category: Neuroscience Source Type: research

Pages: 1  2  3  4  5