Finding of novel telomeric repeats and their distribution in the human genome.
Finding of novel telomeric repeats and their distribution in the human genome.
Genomics. 2020 Apr 19;:
Authors: Alaguponniah S, Krishna DV, Paul S, Christyraj JRSS, Nallaperumal K, Sudhakar S
Abstract
Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.
PMID: 32320819 [PubMed - as supplied by publisher]
Source: Genomics - Category: Genetics & Stem Cells Authors: Alaguponniah S, Krishna DV, Paul S, Christyraj JRSS, Nallaperumal K, Sudhakar S Tags: Genomics Source Type: research