Whole transcriptome analyis of human lung tissue to identify COPD-associated genes.
Abstract Identification of the dysfunctional genes in human lung from patients with Chronic obstructive pulmonary disease (COPD) will help understand the pathology of this disease. Here, using transcriptomic data of lung tissue for 91 COPD cases and 182 matched healthy controls from the Genotype-Tissue Expression (GTEx) database. we identified 1359 significant differentially expressed genes (DEG) with 707 upregulated and 602 downregulated respectively. We evaluated the identified DEGs in an independent microarray cohort of 219 COPD and 108 controls, demonstrating the robustness of our result. Functional annotation...
Source: Genomics - May 26, 2020 Category: Genetics & Stem Cells Authors: Zhu Y, Zhou A, Li Q Tags: Genomics Source Type: research

Characterization of centromeric satellite DNAs (MALREP) in the Asian swamp eel (Monopterus albus) suggests the possible origin of repeats from transposable elements.
Abstract Centromeric satellite DNA (cen-satDNA) sequences of the Asian swamp eel (Monopterus albus) were characterized. Three GC-rich cen-satDNA sequences were detected as a 233 bp MALREP-A and a 293 bp MALREP-B localized to all chromosomes, and a 293 bp MALREP-C distributed on eight chromosome pairs. Sequence lengths of MALREP-B and MALREP-C were 60 bp larger than that of MALREP-A, showing partial homology with core sequences (233 bp). Size differences between MALREP-A and MALREP-B/C suggest the possible occurrence of two satDNA families. The presence of an additional 60 bp in MALREP-B/C resulted from...
Source: Genomics - May 26, 2020 Category: Genetics & Stem Cells Authors: Suntronpong A, Singchat W, Kruasuwan W, Prakhongcheep O, Sillapaprayoon S, Muangmai N, Somyong S, Indanada C, Kraichak E, Peyachoknagul S, Srikulnath K Tags: Genomics Source Type: research

Glaucoma classification based on intra-class and extra-class discriminative correlation and consensus ensemble classifier.
Abstract Automatic classification of glaucoma from fundus images is a vital diagnostic tool for Computer-Aided Diagnosis System (CAD). In this work, a novel fused feature extraction technique and ensemble classifier fusion is proposed for diagnosis of glaucoma. The proposed method comprises of three stages. Initially, the fundus images are subjected to preprocessing followed by feature extraction and feature fusion by Intra-Class and Extra-Class Discriminative Correlation Analysis (IEDCA). The feature fusion approach eliminates between-class correlation while retaining sufficient Feature Dimension (FD) for Correla...
Source: Genomics - May 26, 2020 Category: Genetics & Stem Cells Authors: Kishore B, Ananthamoorthy NP Tags: Genomics Source Type: research

CYP3A4 genetic variants are associated with susceptibility of non-small cell lung cancer in a Shaanxi Han population.
CONCLUSION: Our study indicated that CYP3A4 genetic variants were associated with NSCLC susceptibility in a Shaanxi Han population. PMID: 32464168 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - May 25, 2020 Category: Genetics & Stem Cells Authors: Jia Z, Zhou W, Zhang G, Fu J, Ren L, Li D Tags: Genomics Source Type: research

Association between HOTAIR genetic polymorphisms and cancer susceptibility: A meta-analysis involving 122,832 subjects.
In conclusion, our findings indicated that the rs4759314, rs920778, rs1899663, rs12826786 and rs874945 polymorphisms in HOTAIR may serve as genetic biomarkers of cancer. PMID: 32454167 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - May 23, 2020 Category: Genetics & Stem Cells Authors: Liu X, Zhao Y, Li Y, Lin F, Zhang J Tags: Genomics Source Type: research

iTRAQ-based comparative proteomic analysis reveals high temperature accelerated leaf senescence of tobacco (Nicotiana tabacum L.) during flue-curing.
Abstract Tobacco (Nicotiana tabacum) is extensively cultivated all over the world for its economic value. During curing and storage, senescence occurs, which is associated with physiological and biochemical changes in postharvest plant organs. However, the molecular mechanisms involved in accelerated senescence due to high temperatures in tobacco leaves during curing need further elaboration. We studied molecular mechanisms of senescence in tobacco leaves exposed to high temperature during curing (Fresh, 38 °C and 42 °C), revealed by isobaric tags for relative and absolute quantification (iTRAQ) for th...
Source: Genomics - May 23, 2020 Category: Genetics & Stem Cells Authors: Wu S, Guo Y, Joan HI, Tu Y, Adil MF, Sehar S, Zhao D, Shamsi IH Tags: Genomics Source Type: research

Characterization of the complete mitochondrial genome of Drawida gisti (Metagynophora, Moniligastridae) and comparison with other Metagynophora species.
Abstract Here, the complete mitochondrial genome (mitogenome) of Drawida gisti was sequenced and compared with the mitogenomes of other Metagynophora species. The circular mitogenome was 14,648 bp in length and contained two ribosomal RNA genes (rRNAs), 13 protein-coding genes (PCGs), and 22 transfer RNA genes (tRNAs). The types of constitutive genes and the direction of the coding strand that appeared in Drawida mitogenome were identical to those observed in other Metagynophora species, except for a missing lengthy non-coding region. The conservative relationships between Drawida species were supported by the o...
Source: Genomics - May 23, 2020 Category: Genetics & Stem Cells Authors: Liu H, Xu N, Zhang Q, Wang G, Xu H, Ruan H Tags: Genomics Source Type: research

Plant-pathogen interactions: MicroRNA-mediated trans-kingdom gene regulation in fungi and their host plants.
Abstract MicroRNAs (miRNAs) have been prevalently studied in plants, animals, and viruses. However, recent studies show evidences of miRNA-like RNAs (milRNAs) in fungi as well. It is known that after successful infection, pathogens hijack the host machinery and use it for their own growth and multiplication. Alternatively, resistant plants can overcome the pathogen attack by a variety of mechanisms. Based on this prior knowledge, we computationally predicted milRNAs from 13 fungi, and identified their targets in transcriptomes of the respective fungi as well as their host plants. The expressions of the milRNAs and...
Source: Genomics - May 23, 2020 Category: Genetics & Stem Cells Authors: Mathur M, Nair A, Kadoo N Tags: Genomics Source Type: research

Complete genome sequence analysis of a strain Lactobacillus pentosus ZFM94 and its probiotic characteristics.
Abstract Lactic acid bacteria have been attracting increased attentions recent years because of harboring probiotic properties. In present study, a Lactobacillus pentosus strain ZFM94 was screened from healthy infant feces and its probiotic characteristics were investigated. We found that ZFM94 was resistant to environmental stresses (temperature, pH and NaCl), tolerant to gastrointestinal juice and bile salts, with inhibitory action against pathogens and capacity of folate production etc. Additionally, complete genome sequence of the strain was analyzed to highlight the probiotic features at genetic level. Genomi...
Source: Genomics - May 22, 2020 Category: Genetics & Stem Cells Authors: Ye K, Li P, Gu Q Tags: Genomics Source Type: research

Identification and validation of a six-lncRNA prognostic signature with its ceRNA networks and candidate drugs in lower-grade gliomas.
In conclusion, we identified a 6-lncRNA prognostic signature with its ceRNA networks, and six candidate drugs against LGG. PMID: 32447005 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - May 21, 2020 Category: Genetics & Stem Cells Authors: Lin JZ, Lin N, Zhao WJ Tags: Genomics Source Type: research

Identification and characterization of long non-coding RNAs regulating resistant starch biosynthesis in bread wheat (Triticum aestivum L.).
In this study, we mined 63 transcriptome datasets of wheat belonging to 35 genotypes representing two seed developmental stages. Contrasting expression of a subset of. lncRNAs in RS mutant lines compared to parent wheat variety 'C 306' signifies their probable role in RS biosynthesis. Further, lncRNA- TCONS_00130663 showed strong positive correlation (r2 = 1) with LYPL gene and strong negative correlation with SBEIIb (r2 = -0.94). We found TCONS_00130663 as positive regulator of LYPL gene through interaction with miR1128. Based on relative expression, in-silico interaction and DSC analysis we hypothesize the dual r...
Source: Genomics - May 21, 2020 Category: Genetics & Stem Cells Authors: Madhawan A, Sharma A, Bhandawat A, Rahim MS, Kumar P, Mishra A, Parveen A, Sharma H, Verma SK, Roy J Tags: Genomics Source Type: research

Regulation of related genes promoting resistant in Iris against root rot disease, Fusarium oxysporum f. sp. gladioli.
In this study, three resistant and three susceptible Iris genotypes were inoculated with FOG isolates to evaluate expression of related genes promoting defense to disease at intervals times at two, four and six weeks post inoculation. Total RNA was extracted using an AccuZol™ reagent, and the first-strand Cdna was synthesized accordingly. Expression level of WRKY transcription factors (WRKY), lectin receptor kinase (LecRK), pathogenesis-related protein (PR3), lipoxygenase (LOX1) and ribosome-inactivating proteins (RIP) genes was investigated using quantitative polymerase chain reaction (qPCR). The transcriptional lev...
Source: Genomics - May 17, 2020 Category: Genetics & Stem Cells Authors: Tehrani MM, Nasr-Esfahani M, Mousavi A, Mortezaiinezhad F, Azimi MH Tags: Genomics Source Type: research

Pan-genomics of Ochrobactrum species from clinical and environmental origins reveals distinct populations and possible links.
Abstract Ochrobactrum genus is comprised of soil-dwelling Gram-negative bacteria mainly reported for bioremediation of toxic compounds. Since last few years, mainly two species of this genus, O. intermedium and O. anthropi were documented for causing infections mostly in the immunocompromised patients. Despite such ubiquitous presence, study of adaptation in various niches is still lacking. Thus, to gain insights into the niche adaptation strategies, pan-genome analysis was carried out by comparing 67 genome sequences belonging to Ochrobactrum species. Pan-genome analysis revealed it is an open pan-genome indicati...
Source: Genomics - May 16, 2020 Category: Genetics & Stem Cells Authors: Gohil K, Rajput V, Dharne M Tags: Genomics Source Type: research

Mitochondrial genomes of three Bostrichiformia species and phylogenetic analysis of Polyphaga (Insecta, Coleoptera).
Abstract Here we determined mitogenomes of three Bostrichiformia species. These data were combined with 51 previously sequenced Polyphaga mitogenomes to explore the higher-level relationships within Polyphaga by using four different mitogenomic datasets and three tree inference approaches. Among Polyphaga mitogenomes we observed heterogeneity in nucleotide composition and evolutionary rates, which may have affected phylogenetic inferences across the different mitogenomic datasets. Elateriformia, Cucujiformia, and Scarabaeiformia were each inferred to be monophyletic by all analyses, as was Bostrichiformia by most ...
Source: Genomics - May 14, 2020 Category: Genetics & Stem Cells Authors: Tang PA, Feng RQ, Zhang L, Wang J, Wang XT, Zhang LJ, Yuan ML Tags: Genomics Source Type: research

Minimum error calibration and normalization for genomic copy number analysis.
CONCLUSIONS: Mecan4CNA provides an advanced method for CNA data normalization, especially in meta-analyses involving large profile numbers and heterogeneous source data quality. With its informative output and visualization options, Mecan4CNA also can improve the interpretation of individual CNA profiles. Mecan4CNA is freely available as a Python package and through its code repository on Github. PMID: 32413400 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - May 12, 2020 Category: Genetics & Stem Cells Authors: Gao B, Baudis M Tags: Genomics Source Type: research

Soybean-derived miRNAs specifically inhibit proliferation and stimulate apoptosis of human colonic Caco-2 cancer cells but not normal mucosal cells in culture.
In this study, we found that soybean-derived small RNAs (sRNAs) significantly inhibited the proliferation and stimulated the apoptosis of Caco-2 cells. Bioinformatics analysis indicated that the target gene set of soybean miRNAs was extensively enriched in cancer pathways. Besides, we obtained 8 target genes, including Transcription factor 7 (TCF7), associated with colon cancer through prediction. Further studies showed that gma-miR159a inhibited the proliferation of Caco-2 cells and played an important role in the inhibitory effect of sRNAs by inhibiting TCF7 protein, which are upregulated in colon cancer cells but not no...
Source: Genomics - May 11, 2020 Category: Genetics & Stem Cells Authors: Liu J, Wang F, Weng Z, Sui X, Fang Y, Tang X, Shen X Tags: Genomics Source Type: research

Whole-genome sequencing of the endemic Antarctic fungus Antarctomyces pellizariae reveals an ice-binding protein, a scarce set of secondary metabolites gene clusters and provides insights on Thelebolales phylogeny.
Abstract The snow-covered surfaces of Antarctica comprise an extreme environment that favors the development of life forms with adaptations to adverse low-temperature habitats. The ability to survive and such temperatures might involve the production of antifreeze proteins and ice-binding proteins that attenuate the effects of intense cold temperatures. He, we sequenced and reconstructed the nuclear and mitochondrial genomes of the endemic Antarctic fungus Antarctomyces pellizariae UFMGCB 12416. We then have identified a putative ice-binding protein-coding gene, mapped the presence of secondary metabolite gene clu...
Source: Genomics - May 7, 2020 Category: Genetics & Stem Cells Authors: Batista TM, Hilario HO, de Brito GAM, Moreira RG, Furtado C, de Menezes GCA, Rosa CA, Rosa LH, Franco GR Tags: Genomics Source Type: research

Parental somatic mosaicism for CNV deletions - A need for more sensitive and precise detection methods in clinical diagnostics settings.
Abstract To further assess the scale and level of parental somatic mosaicism, we queried the CMA database at Baylor Genetics. We selected 50 unrelated families where clinically relevant apparent de novo CNV-deletions were found in the affected probands. Parental blood samples screening using deletion junction-specific PCR revealed four parents with somatic mosaicism. Droplet digital PCR (ddPCR), qPCR, and amplicon-based next-generation sequencing (NGS) were used. Using ddPCR levels of mosaicism ranged from undetectable to 18.5%. Amplicon-based NGS and qPCR for the father with undetectable mosaicism was able to det...
Source: Genomics - May 6, 2020 Category: Genetics & Stem Cells Authors: Liu Q, Karolak JA, Grochowski CM, Wilson TA, Rosenfeld JA, Bacino CA, Lalani SR, Patel A, Breman A, Smith JL, Cheung SW, Lupski JR, Bi W, Stankiewicz P Tags: Genomics Source Type: research

The cognitive and speech genes are jointly shaped by both positive and relaxed selection in the human lineage.
Abstract The emergence of a coordinated network of cognitive and speech genes in the human lineage performing overlapping functions is a great evolutionary puzzle. Prior studies on the speech gene FOXP2 are inconclusive on the nature of selection operating on this gene in the human lineage. Here, I show that the evolution of FOXP2 is accelerated in the human lineage due to relaxation of purifying selection (relaxed selection). Five potential genes associated with human-specific intelligence and speech genes have evolved under the impact of positive selection and three genes including FOXP2 have undergone relaxatio...
Source: Genomics - May 6, 2020 Category: Genetics & Stem Cells Authors: Tiwary BK Tags: Genomics Source Type: research

miRDetect: A combinatorial approach for automated detection of novel miRNA precursors from plant EST data using homology and Random Forest classification.
Abstract Identification of microRNAs from plants is a crucial step for understanding the mechanisms of pathways and regulation of genes. A number of tools have been developed for the detection of microRNAs from small RNA-seq data. However, there is a lack of a pipeline for detection of miRNA from EST dataset even when a huge resource is publicly available and the method is known. Here we present, miRDetect a python implementation to detect novel miRNA precursors from plant EST data using homology and machine learning approach. 10-fold cross validation was applied to choose best classifier based on ROC, accuracy, M...
Source: Genomics - May 4, 2020 Category: Genetics & Stem Cells Authors: Ayachit G, Pandya H, Das J Tags: Genomics Source Type: research

Whole genome sequence of Diaporthe capsici, a new pathogen of walnut blight.
Abstract Many fungi in the Diaporthe genus across the world are pathogenic. Diaporthe capsici. is a pathogenic fungus that can infect peppers and walnuts, causing their death. The aim of this study was to develop a genomic resource to provide substantial data and a theoretical basis for research on molecular pathogenesis, transcriptome, proteome, and metabonome of D. capsici. The whole genome of D. capsici was sequenced using the PacBio RSII sequencing platform, and functional annotation was performed using different public databases. The genome was found to be 57.56 Mb in size, with an N50 contig size of 5,171,...
Source: Genomics - May 1, 2020 Category: Genetics & Stem Cells Authors: Fang X, Qin K, Li S, Han S, Zhu T, Fang X, Qin K Tags: Genomics Source Type: research

CancerEnD: A database of cancer associated enhancers.
Abstract CancerEnD is an integrated resource developed for annotating 8524 unique expressed enhancers, associated genes, somatic mutations and copy number variations of 8063 cancer samples from 18 cancer types of TCGA. Somatic mutation data was taken from the COSMIC repository. To delineate the relationship of change in copy number of enhancer elements with the prognosis of cancer patients, survival analysis was done using the survival package in R. We identified 1762 overall survival associated enhancers, which can be used for prognostic purposes for cancer patients in a tissue-specific manner. CancerEnD (https:/...
Source: Genomics - April 30, 2020 Category: Genetics & Stem Cells Authors: Kumar R, Lathwal A, Kumar V, Patiyal S, Raghav PK, Raghava GPS Tags: Genomics Source Type: research

The conserved mitochondrial genome of the jewel beetle (Coleoptera: Buprestidae) and its phylogenetic implications for the suborder Polyphaga.
This study not only presents the mt genome of a species in the family Buprestidae and a comparative analysis of jewel beetles but also examines the contribution of mt genomes in elucidating phylogenetic relationships within the suborder Polyphaga of Coleoptera. PMID: 32360911 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - April 30, 2020 Category: Genetics & Stem Cells Authors: Sun H, Zhao W, Lin R, Zhou Z, Huai W, Yao Y Tags: Genomics Source Type: research

Silencing Sirtuin 6 induces cell cycle arrest and apoptosis in non-small cell lung cancer cell lines.
Abstract Sirtuins (SIRT1-7), are NAD-dependent deacetylases and ADP-ribosyl transferases, plays a major part in carcinogenesis. The previous report suggests that in cancer sirtuins gained tremendous interest and critical regulators of the unusual processes. In carcinogenesis, sirtuins possess either tumor suppressor or promoter. However, in lung cancer condition the studies of sirtuins are less studied. Hence, this designed study investigates the impact of multifaceted sirtuins in NSCLC cells. We evaluated the mRNA and protein expressions of sirtuins by RTPCR and western blot. We found SIRT6 significantly overexpr...
Source: Genomics - April 29, 2020 Category: Genetics & Stem Cells Authors: Krishnamoorthy V, Vilwanathan R Tags: Genomics Source Type: research

Silencing of S-phase kinase-associated protein 2 enhances radiosensitivity of esophageal cancer cells through inhibition of PI3K/AKT signaling pathway.
Abstract We investigated the effect of S-phase kinase-associated protein 2 (SKP2) on radiosensitivity of esophageal cancer (EC) cells. Expression of SKP2, PI3K, AKT, Bcl-2 and Bax were assayed in EC. EC cells were transfected with SKP2-siRNA/IGF-1 to detect expression of SKP2, PI3K, AKT, Bcl-2 and Bax. At last, the radiosensitivity of cells in different doses of X (0, 2, 4, 6, 8 Gy) irradiation and cell apoptosis were also detected. EC cells displayed a higher positive expression rate of SKP2, elevated mRNA and protein expression of SKP2, PI3K, AKT, Bcl-2 and Bax, as well as higher extent of PI3K and AKT phospho...
Source: Genomics - April 29, 2020 Category: Genetics & Stem Cells Authors: Wang C, Li S, Liu J, Cheng M, Wang D, Wang Y, Lu B Tags: Genomics Source Type: research

Long noncoding RNA and mRNA profiling of hypothalamic-pituitary-mammary gland axis in lactating sows under heat stress.
In this study, we performed RNA sequencing and bioinformatics analysis of the hypothalamus, pituitary, and mammary gland tissues of lactating sows under HS and thermal comfort. In total, the analysis identified 658, 6021, and 6745 differently expressed (DE) mRNAs, 26, 126, and 169 DE lncRNAs between comparison groups in the hypothalamus, pituitary, and mammary glands, respectively. The hormone genes and most DE mRNAs encoding heat shock protein were differently expressed in the HS group. In addition, 2, 60, and 86 pairs of DE lncRNAs and mRNAs correlation were observed in those tissues, respectively. Some lncRNAs may be in...
Source: Genomics - April 28, 2020 Category: Genetics & Stem Cells Authors: Ni Y, Wu F, Chen Q, Cai J, Hu J, Shen J, Zhang J Tags: Genomics Source Type: research

Genotyping coronavirus SARS-CoV-2: Methods and implications.
This study presents an accurate method for effectively genotyping SARS-CoV-2 viruses using complete genomes. The method employs the multiple sequence alignments of the genome isolates with the SARS-CoV-2 reference genome. The single-nucleotide polymorphism (SNP) genotypes are then measured by Jaccard distances to track the relationship of virus isolates. The genotyping analysis of SARS-CoV-2 isolates from the globe reveals that specific multiple mutations are the predominated mutation type during the current epidemic. The proposed method serves an effective tool for monitoring and tracking the epidemic of pathogenic viruse...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Yin C Tags: Genomics Source Type: research

Evaluation of off-targets predicted by sgRNA design tools.
Abstract The ease of programming CRISPR/Cas9 system for targeting a specific location within the genome has paved way for many clinical and industrial applications. However, its widespread use is still limited owing to its off-target effects. Though this off-target activity has been reported to be dependent on both sgRNA sequence and experimental conditions, a clear understanding of the factors imparting specificity to CRISPR/Cas9 system is important. A machine learning-based computational model has been developed for prediction of off-targets with more likelihood to be cleaved in vivo with an accuracy of 91.49%. ...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Dhanjal JK, Dammalapati S, Pal S, Sundar D Tags: Genomics Source Type: research

De novo assembly transcriptome analysis reveals the preliminary molecular mechanism of pigmentation in juveniles of the hard clam Mercenaria mercenaria.
Abstract Color plays a vital function in camouflage, sexual selection, immunity, and evolution. Mollusca possess vivid shell colors and pigmentation starts at the juvenile stage. The hard clam Mercenaria mercenaria is a widely cultivated bivalve of high economic value. To explore the molecular mechanism of pigmentation in juvenile clams, here, we performed RNA-Seq analysis on non-pigmented, white, and red M. mercenaria specimens. Clean reads were assembled into 358,285 transcripts and 149,234 unigenes, whose N50 lengths were 2107 bp and 1567 bp, respectively. Differentially expressed genes were identified and ...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Hu Z, Song H, Zhou C, Yu ZL, Yang MJ, Zhang T Tags: Genomics Source Type: research

Comparative transcriptome analysis of differentially expressed genes in Bradysia odoriphaga Yang et Zhang (Diptera: Sciaridae) at different acute stress temperatures.
Abstract The gnat, Bradysia odoriphaga Yang et Zhang, is an important underground pest in Asia. B. odoriphaga differ in heat and cold tolerance and exhibit quite different developmental strategies. To understand the underlying mechanisms, we sequenced and compared the transcriptome of B. odoriphaga under 40 °C (a stressful high temperature), 25 °C, and 4 °C (a stressful low temperature) for 1 h. We found that metabolism- and ribosome-related genes were modulated. In high temperature (40 °C), heat shock protein (HSP) genes, detoxication genes, metabolism genes, protein turnover genes, and ...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Cheng J, Su Q, Xia J, Yang Z, Shi C, Wang S, Wu Q, Li C, Zhang Y Tags: Genomics Source Type: research

Structural changes induced by substitution of amino acid 129 in the coat protein of cucumber mosaic virus.
Abstract Cucumber mosaic virus infection leads to mosaic symptoms on a broad range of crop plants. Mutation at positions 129 in the coat protein of virus causes alterations in the severity of symptoms caused by the viral infection. In our investigation, we performed long term molecular dynamics simulations to elucidate the effect of different amino acid substitutes (infectious and non-infectious) at position 129 in the coat protein of Cucumber mosaic virus using various structural parameters. We found that the contagious mutants displayed more flexibility at loops βE-αEF (129-136) and βF-βG lo...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Bhardwaj V, Purohit R Tags: Genomics Source Type: research

Genetic and epigenetic stability of stem cells: Epigenetic modifiers modulate the fate of mesenchymal stem cells.
Abstract Stem cell research has progressed widely and has been receiving a considerable attention for its advantages and drawbacks. Despite their extensive therapeutic potential in regenerative medicine, they are debatable for their genetic and epigenetic stability. In fact lineage specific differentiation is mediated via epigenetic changes in DNA methylation, acetylation, histone modifications etc. Thus epigenetics plays an important role in stem cell biology. For therapeutic interventions stem cells need to be genetically and epigenetically stable for their maximum paracrine secretions for bringing about expecte...
Source: Genomics - April 27, 2020 Category: Genetics & Stem Cells Authors: Sharma S, Bhonde R Tags: Genomics Source Type: research

Next generation sequencing exome data analysis aids in the discovery of SNP and INDEL patterns in Parkinson's disease.
Abstract Whole exome sequencing is an adept method to reveal novel and disease-related SNPs and INDELs as it screen the actionable areas of the genome. We evaluated the exome sequenced datasets of patients with Parkinson's disease (PD) in South African ethnic origin. The primary focus of this study was to discover the SNPs and INDELs patterns responsible for PD. The variant discovery was performed with genome analysis tool kit best practices variant detection pipelines. The SNPs were linked to the genes and categorized based on the filter-based annotation from ANNOVAR. We identified a total of 7955 SNPs and 9952 I...
Source: Genomics - April 26, 2020 Category: Genetics & Stem Cells Authors: Odumpatta R, Arumugam M Tags: Genomics Source Type: research

CYP2R1 and CYP27A1 genes: An in silico approach to identify the deleterious mutations, impact on structure and their differential expression in disease condition.
Abstract Mutations in CYP2R1 and CYP27A1 involved in the conversion of Cholecalciferol into Calcidiol were associated with the impaired 25-hydroxylase activity therefore affecting the Vitamin D metabolism. Hence, this study attempted to understand the influence of genetic variations at the sequence and structural level via computational approach. The non-synonymous mutations retrieved from dbSNP database were assessed for their pathogenicity, stability as well as conservancy using various computational tools. The above analysis predicted 11/260 and 35/489 non-synonymous mutations to be deleterious in CYP2R1 and CY...
Source: Genomics - April 25, 2020 Category: Genetics & Stem Cells Authors: Sunkar S, Neeharika D Tags: Genomics Source Type: research

Complete genome sequence of Sphingomonas sp. Cra20, a drought resistant and plant growth promoting rhizobacteria.
Abstract Sphingomonas sp. Cra20 is a rhizobacteria isolated from the root surface of Leontopodium leontopodioides in the Tianshan Mountains of China and was found to influence root system architecture. We analyzed its ability for plant-growth promotion and the molecular mechanism involved by combining the physiological and genome information. The results indicated that the bacterium enhanced the drought resistance of Arabidopsis thaliana and promoted growth mainly through the strain-released volatile organic compounds. The genome consisted of one circular chromosome and one circular plasmid, containing a series of...
Source: Genomics - April 22, 2020 Category: Genetics & Stem Cells Authors: Luo Y, Zhou M, Zhao Q, Wang F, Gao J, Sheng H, An L Tags: Genomics Source Type: research

Integrating transcriptome, proteome and QTL data to discover functionally important genes for duck eggshell and albumen formation.
Abstract Duck egg quality improvement is an essential target for Asian poultry breeding. In total, 15 RNA-Seq libraries (magnum, isthmus, and uterus at two different physiological states) were sequenced from 48 weeks old Pekin ducks. De novo assembly and annotation methods were utilized to generate new reference transcripts. Our results revealed that 1264 and 2517 genes were differentially expressed in magnum and uterus in the presence versus absence of an egg, respectively. We identified 1089 genes that were differentially expressed in isthmus compared to uterus (in both presence and absence of a calcifying egg...
Source: Genomics - April 22, 2020 Category: Genetics & Stem Cells Authors: Zhang F, Yin ZT, Zhang JF, Zhu F, Hincke M, Yang N, Hou ZC Tags: Genomics Source Type: research

Pathogenic and antimicrobial resistance genes in Streptococcus oralis strains revealed by comparative genome analysis.
In this study, we built a complete genome map of Streptococcus oralis strain SOT, Streptococcus oralis strain SOD and Streptococcus infantis strain SO and performed comparative genomic analysis among these three strains. The results showed that there are five genomic islands (GIs) in strain SOT and one CRISPR in strain SOD. Each genome harbors various pathogenic genes related to diseases and drug resistance, while the antibiotic resistance genes in strains SOT and SOD were quite similar but different from those in strain SO. In addition, we identified 17 main virulence factors and capsule-related genes in three strains. Th...
Source: Genomics - April 22, 2020 Category: Genetics & Stem Cells Authors: Zhou J, Sun T, Kang W, Tang D, QiangFeng Tags: Genomics Source Type: research

Downregulation of lncRNA ZFAS1 and upregulation of microRNA-129 repress endocrine disturbance, increase proliferation and inhibit apoptosis of ovarian granulosa cells in polycystic ovarian syndrome by downregulating HMGB1.
CONCLUSION: LncRNA ZFAS1 could bind to miR-129 to promote HMGB1 expression, thereby affecting the endocrine disturbance, proliferation and apoptosis of ovarian granulosa cells in PCOS. PMID: 32320818 [PubMed - as supplied by publisher] (Source: Genomics)
Source: Genomics - April 19, 2020 Category: Genetics & Stem Cells Authors: Zhu HL, Chen YQ, Zhang ZF Tags: Genomics Source Type: research

Finding of novel telomeric repeats and their distribution in the human genome.
Abstract Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions mi...
Source: Genomics - April 19, 2020 Category: Genetics & Stem Cells Authors: Alaguponniah S, Krishna DV, Paul S, Christyraj JRSS, Nallaperumal K, Sudhakar S Tags: Genomics Source Type: research

Identification and characterization of trait-specific SNPs using ddRAD sequencing in water buffalo.
Abstract Single Nucleotide Polymorphism (SNP) is one of the important molecular markers widely used in animal breeding program for improvement of any desirable genetic traits. Considering this, the present study was carried out to identify, annotate and analyze the SNPs related to four important traits of buffalo viz. milk volume, age at first calving, post-partum cyclicity and feed conversion efficiency. We identified 246,495, 168,202, 74,136 and 194,747 genome-wide SNPs related to mentioned traits respectively using ddRAD sequencing technique based on 85 samples of Murrah Buffaloes. Distribution of these SNPs ar...
Source: Genomics - April 19, 2020 Category: Genetics & Stem Cells Authors: Mishra DC, Sikka P, Yadav S, Bhati J, Paul SS, Jerome A, Singh I, Nath A, Budhlakoti N, Rao AR, Rai A, Chaturvedi KK Tags: Genomics Source Type: research

Ammonium transporter 1 (AMT1) gene family in tomato (Solanum lycopersicum L.): Bioinformatics, physiological and expression analyses under drought and salt stresses.
Abstract Nitrogen (N) is an essential macronutrient for plants, and mainly taken from the soil as ammonium (NH+4). It is particularly transported into the plants by AMmonium Transporters (AMTs), which are plasma membrane proteins. In the present study, genome-wide identification, physiological and expression analyses of tomato (Solanum lycopersicum L.) ammonium transporters 1 (SlAMT1) genes under drought and salt stresses were performed. Sequence analyses revealed the presence of variations in SlAMT1s at nucleotide and protein levels. While all the SlAMT1s comprise an ammonium transporter domain (PF00909), the num...
Source: Genomics - April 19, 2020 Category: Genetics & Stem Cells Authors: Filiz E, Akbudak MA Tags: Genomics Source Type: research

Interactions between Lactobacillus plantarum NCU116 and its environments based on extracellular proteins and polysaccharides prediction by comparative analysis.
Abstract Lactic acid bacteria (LAB) play a significant role in food industry and artisan fermented-food. Most of the applicable LABs were commonly obtained from natural fermented food or human gut. And Lactobacillus plantarum NCU116 was screened from a LAB-dominated traditional Chinese sauerkraut (TCS). In order to comprehend the interaction between NCU116 and its environments, comparative genomics were performed to identify genes involved in extracellular protein biosynthesis and secretion. Four secretory pathways were identified, including Sec and FPE pathways, holins and efflux ABC transporter system. Then 348 ...
Source: Genomics - April 19, 2020 Category: Genetics & Stem Cells Authors: Huang T, Peng Z, Hu M, Xiao YS, Liu ZG, Guan QQ, Xie MY, Xiong T Tags: Genomics Source Type: research

Genome-wide identification and abiotic stress response patterns of abscisic acid stress ripening protein family members in Triticum aestivum L.
This study identified 29 ASR genes in wheat. 23 pairs of tandem duplication genes and six pairs of segmental duplication genes were found in wheat ASR (TaASR) gene family, respectively. It is speculated that gene duplication event is the main driving force of TaASR genes evolution. Using published RNA-seq data and the qRT-PCR results of 12 TaASR genes, we analyzed the expression profiles for TaASR genes under abiotic stresses. It found that most of the genes mainly responded to salt and low temperature stress. Finally, subcellular localization and self-activation experiments showed that the proteins encoded by 12 TaASR gen...
Source: Genomics - April 15, 2020 Category: Genetics & Stem Cells Authors: Zan T, Li L, Xie T, Zhang L, Li X Tags: Genomics Source Type: research

Epigenomic regulation of OTU5 in Arabidopsis thaliana.
Abstract Epigenetic regulation by DNA methylation and histone marks is crucial to plant development. In Arabidopsis, the otu5 mutant exhibited altered root phenotypes resembling those of phosphate-deficient plants. In low phosphate (Pi) conditions, altered H3K4 and H3K27 trimethylation were associated with the expression of Pi homeostasis-related genes. However, the genetic effect of OTU5 on the epigenomes was left unexplored. We assessed genome-wide DNA methylation, gene expression and histone modifications of roots from both Col-0 and otu5 mutants. We found that OTU5 altered DNA methylation profile with a contex...
Source: Genomics - April 13, 2020 Category: Genetics & Stem Cells Authors: Hsieh JA, Yen MR, Chen PY Tags: Genomics Source Type: research

Mitochondrial DNA (hypervariable region I) diversity in Basrah population - Iraq.
Abstract In attempt to investigate the origin of Basrah, we examined the mitochondrial DNA(mt-DNA) variations by hypervariable segment 1(HVS1) Sequencing and determination of specific site haplogroups. In Basrah, no significant differences diversity among Iraqis' HVS1 compared with other countries. The values were within the range of gene diversity across the Middle East and exhibited the unimodal pattern of differences in the pairwise sequence. Given the small genetic differences between people living in this area, phylogenetic analysis showed a large variability of the communities of Basrah; they didn't cluster ...
Source: Genomics - April 11, 2020 Category: Genetics & Stem Cells Authors: Ohied BM, Al-Badran AI Tags: Genomics Source Type: research

Bi-sulphite sequencing reveals dynamic DNA methylation under desiccation and salinity stresses in rice cultivars.
Abstract DNA methylation governs gene regulation in plants in response to environmental conditions. Here, we analyzed role of DNA methylation under desiccation and salinity stresses in three (IR64, stress-sensitive; Nagina 22, drought-tolerant and Pokkali, salinity-tolerant) rice cultivars via bisulphite sequencing. Methylation in CG context within gene body and methylation in CHH context in distal promoter regions were positively correlated with gene expression. Hypomethylation in Nagina 22 and hypermethylation in Pokkali in response to desiccation and salinity stresses, respectively, were correlated with higher ...
Source: Genomics - April 8, 2020 Category: Genetics & Stem Cells Authors: Rajkumar MS, Shankar R, Garg R, Jain M Tags: Genomics Source Type: research

Genome-wide identification, characterization and expression analysis of the amino acid permease gene family in tea plants (Camellia sinensis).
In this study, 19 AAP genes were identified from the tea plants genome database and named CsAAP1-19. Based on phylogenetic analysis, the CsAAP genes were classified into three groups, having significantly different structures and conserved motifs. In addition, an expression analysis revealed that most of CsAAP genes were specifically expressed in different tissues, especially CsAAP19 was expressed only in root. These genes also were significantly expressed in the Baiye 1 and Huangjinya cultivars. Nitrogen treatments indicated that the CsAAPs were obviously expressed in root. CsAAP2, -6, -12, -13 and - 16 were significa...
Source: Genomics - April 7, 2020 Category: Genetics & Stem Cells Authors: Duan Y, Zhu X, Shen J, Xing H, Zou Z, Ma Y, Wang Y, Fang W Tags: Genomics Source Type: research

NGS-based characterization of microbial diversity and functional profiling of solid tannery waste metagenomes.
Abstract Tanneries pose a serious threat to the environment by generating large amount of solid tannery waste (STW). Two metagenomes representing tannery waste dumpsites Jajmau (JJK) and Unnao (UNK) were sequenced using Illumina HiSeq platform. Microbial diversity analysis revealed domination of Proteobacteria, Firmicutes, Bacteroidetes, Actinobacteria, and Planctomycetes in both metagenomes. Presence of pollutant degrading microbes such as Bacillus, Clostridium, Halanaerobium and Pseudomonas strongly indicated their bioremediation ability. KEGG and SEED annotated main functional categories included carbohydrate m...
Source: Genomics - April 6, 2020 Category: Genetics & Stem Cells Authors: Verma SK, Sharma PC Tags: Genomics Source Type: research

MicroRNA expression in the heart of Xenopus laevis facilitates metabolic adaptation to dehydration.
Abstract Xenopus laevis survive severe dehydration during the summer months in their natural range. MicroRNA regulate translation of target mRNAs and have shown to be differentially expressed in response to dehydration in X. laevis. During dehydration, heart rate is elevated which appears to compensate for the reduced oxygen delivery capability due to increased hematocrit. We hypothesized that microRNAs would be differentially expressed in the heart to modulate gene expression levels in response to dehydration. The present study assessed changes in the microRNAome of X. laevis heart in response to severe dehydrati...
Source: Genomics - April 4, 2020 Category: Genetics & Stem Cells Authors: Hawkins LJ, Storey KB Tags: Genomics Source Type: research

Comparative genomic analysis of Erwinia amylovora reveals novel insights in phylogenetic arrangement, plasmid diversity, and streptomycin resistance.
ev AM Abstract Erwinia amylovora is a destructive pathogen of Rosaceous plants and an economic concern worldwide. Herein, we report 93 new E. amylovora genomes from North America, Europe, the Mediterranean, and New Zealand. This new genomic information demonstrates the existence of three primary clades of Amygdaloideae (apple and pear) infecting E. amylovora and suggests all three independently originate from North America. The comprehensive sequencing also identified and confirmed the presence of 7 novel plasmids ranging in size from 2.9 to 34.7 kbp. While the function of the novel plasmids is unknown, the plasmi...
Source: Genomics - April 4, 2020 Category: Genetics & Stem Cells Authors: Parcey M, Gayder S, Morley-Senkler V, Bakkeren G, Úrbez-Torres JR, Ali S, Castle AJ, Svircev AM Tags: Genomics Source Type: research