Fracture liaison services for osteoporosis in the Asia-Pacific region: current unmet needs and systematic literature review
AbstractThe analysis aimed to identify the treatment gaps in current fracture liaison services (FLS) and to provide recommendations for best practice establishment of future FLS across the Asia-Pacific region. The findings emphasize the unmet need for the implementation of new programs and provide recommendations for the refinement of existing ones. The study ’s objectives were to evaluate fracture liaison service (FLS) programs in the Asia-Pacific region and provide recommendations for establishment of future FLS programs. A systematic literature review (SLR) of Medline, PubMed, EMBASE, and Cochrane Library (2000&nd...
Source: Osteoporosis International - December 28, 2017 Category: Orthopaedics Source Type: research

Hip fracture trends in the United States, 2002 to 2015
ConclusionsThe plateau in age-adjusted hip fracture incidence rate resulted in more than 11,000 additional estimated hip fractures over the time periods 2013, 2014, and 2015. We recommend further study to assess all factors contributing to this remarkable change in hip fracture rate and to develop strategies to reduce the osteoporosis treatment gap. (Source: Osteoporosis International)
Source: Osteoporosis International - December 27, 2017 Category: Orthopaedics Source Type: research

Stimulation of intestinal calcium absorption by orally administrated vitamin D3 compounds: a prospective open-label randomized trial in osteoporosis
ConclusionThese findings suggest that oral administration of vitamin D3 analogues (ALF and ELD) stimulates FCA but plain vitamin D3 does not. Those effects of vitamin D3 compounds on FCA were independent of serum calcitriol concentration, suggesting that ALF and ELD may directly stimulate intestinal vitamin D receptors. (Source: Osteoporosis International)
Source: Osteoporosis International - December 23, 2017 Category: Orthopaedics Source Type: research

FRAX-based intervention and assessment thresholds in seven Latin American countries
ConclusionsIn the LA countries, FRAX-based IT offers a substantial advance for the detection of men and women at high fracture risk, particularly in the elderly. The heterogeneity of IT between the LA countries indicates that country-specific FRAX models are appropriate rather than a global LA model. (Source: Osteoporosis International)
Source: Osteoporosis International - December 23, 2017 Category: Orthopaedics Source Type: research

Acetylcholinesterase inhibitors and the risk of osteoporotic fractures: nested case-control study
ConclusionsIn this study using large primary care databases, the use and treatment adherence to AChEIs were associated with a decreased risk of osteoporotic fractures in elderly AD patients. (Source: Osteoporosis International)
Source: Osteoporosis International - December 20, 2017 Category: Orthopaedics Source Type: research

Vitamin D supplementation and bone turnover in advanced heart failure: the EVITA trial
AbstractSummaryLow vitamin D status is common in patients with heart failure and may influence bone health. A daily vitamin D dose of 4000  IU (moderately high dose) for 3 years had however no effect on parameters of bone metabolism, even in patients with very low vitamin D status.IntroductionLow vitamin D status is common in patients with heart failure (HF) and has been related to disturbed bone turnover. The present study investigated the effect of a daily vitamin D3 dose of 4000  IU on bone turnover markers (BTMs) in patients with advanced HF and 25-hydroxyvitamin D (25OHD) concentrations
Source: Osteoporosis International - December 19, 2017 Category: Orthopaedics Source Type: research

Appropriateness criteria for treatment of osteoporotic vertebral compression fractures
AbstractThe purpose of this study was to review and summarise the literature on appropriateness criteria for treatment of osteoporotic vertebral compression fractures (OVCF), with appropriateness defined as a treatment where the expected benefits outweigh the expected harms, confirmed by available evidence and expert opinion. A comprehensive search of peer-reviewed publications (PubMed, EMBASE) and grey literature was performed. To be included for analysis, documents had to be a review article (e.g. clinical guideline or meta-analysis), focus on OVCF and make a statement on treatment appropriateness. Eleven publications fu...
Source: Osteoporosis International - December 19, 2017 Category: Orthopaedics Source Type: research

A dedicated Fracture Liaison Service telephone program and use of bone turnover markers for evaluating 1-year persistence with oral bisphosphonates
AbstractSummaryTelephone call intervention did not improve alendronate persistence in Fracture Liaison Service (FLS) patients in this study. A bone turnover marker cut-off point for alendronate persistence is proposed for individual FLS patients.IntroductionFLS aims to prevent subsequent fractures, which should include improving patients ’ persistence with prescribed oral bisphosphonates. We studied the influence of telephone calls and the predictive value of changes in bone turnover markers (BTMs) for evaluating persistence with alendronate.MethodsPostmenopausal women with a recent fracture and osteoporosis who star...
Source: Osteoporosis International - December 19, 2017 Category: Orthopaedics Source Type: research

Abaloparatide, a novel PTH receptor agonist, increased bone mass and strength in ovariectomized cynomolgus monkeys by increasing bone formation without increasing bone resorption
ConclusionsAbaloparatide administration was associated with increases in bone formation, bone mass and bone strength, and with maintenance of bone quality in OVX cynos, without increases in serum calcium or bone resorption parameters. (Source: Osteoporosis International)
Source: Osteoporosis International - December 19, 2017 Category: Orthopaedics Source Type: research

Remarkable improvement in serum 25-hydroxyvitamin levels among hip fracture patients over a 12-year period: a prospective study in South-eastern Finland
The objectives of this study are to verify vitamin D levels among hip fracture patients and to compare the results with a similar study conducted in the same two hospitals covering the same geographic area 12  years ago.MethodsA prospective cohort comprising 245 Caucasian hip fracture patients was enrolled in the study in two acute hospitals in south-eastern Finland (61 ° N) over a 12-month period in 2015–2016. The S-25(OH)D was measured using 25-hydroxyvitamin D electrochemiluminescence binding assay. The S-25(OH)D concentrations were compared with the corresponding concentrations of a similar cohort analyz...
Source: Osteoporosis International - December 19, 2017 Category: Orthopaedics Source Type: research

Teriparatide therapy for severe, refractory osteoradionecrosis of the jaw
AbstractAlthough osteoradionecrosis (ORN) is a serious complication of craniofacial radiotherapy, the current management methods remain suboptimal. Teriparatide (TPTD), a recombinant human parathyroid hormone (1 –34), has shown beneficial effects on osseous regeneration in medication-related osteonecrosis of the jaw or periodontitis. However, TPTD therapy in irradiated bones has not been indicated yet because of the theoretical risk of osteosarcoma seen in rat models. Hence, we first report here two patie nts with tongue cancer with late-emerging ORN who were successfully treated with TPTD for 4–6 months w...
Source: Osteoporosis International - December 16, 2017 Category: Orthopaedics Source Type: research

Worsening of soft tissue dystrophic calcification in an osteoporotic patient treated with teriparatide
We report a patient with severe osteoporosis and without a pre-existing autoimmune disorder, who developed symptomatic worsening of dystrophic calcification 4  months after teriparatide was initiated. Symptoms resolved within 1 week of teriparatide cessation. (Source: Osteoporosis International)
Source: Osteoporosis International - December 15, 2017 Category: Orthopaedics Source Type: research

Quality of life for up to 18  months after low-energy hip, vertebral, and distal forearm fractures—results from the ICUROS
This study used data from the International Costs and Utilities Related to Osteoporotic fractures Study (ICUROS) to estimate the quality of life (QoL) impact of fracture. Hip, vertebral, and distal forearm fractures incur substantial QoL losses. Hip and vertebral fracture results in markedly impaired QoL for at least 18  months.IntroductionThe International Costs and Utilities Related to Osteoporotic fractures Study (ICUROS) is a multinational observational study that aims to describe costs and quality of life (QoL) consequences of osteoporotic fractures. To date, 11 countries have participated in the study: Australia...
Source: Osteoporosis International - December 11, 2017 Category: Orthopaedics Source Type: research

Rebound-associated vertebral fractures after discontinuation of denosumab for the treatment of maxillitis
We reported a 69-year-old female who discontinued denosumab due to dental treatment and subsequently suffered rebound-associated vertebral fractures 10 months after the last injection. This case raised an alarm regarding the discontinuation of denosumab for dental treatment. Denosumab, a human monoclonal antibody administered by subcutaneous injection, to the best of our knowledge, is the only fully investigated inhibitor of receptor activator of nuclear factor kappa B ligand. Discontinuation of denosumab leads to bone turnover rebound and rapid bone mineral density loss. Several studies have reported rebound-associated ve...
Source: Osteoporosis International - December 11, 2017 Category: Orthopaedics Source Type: research

Effectiveness of a two-step population-based osteoporosis screening program using FRAX: the randomized Risk-stratified Osteoporosis Strategy Evaluation (ROSE) study
ConclusionsCompared to an office-based case-finding strategy, the two-step systematic screening strategy had no overall effect on fracture incidence. The two-step strategy seemed, however, to be beneficial in the group of women who were identified by FRAX as moderate- or high-risk patients and complied with DXA. (Source: Osteoporosis International)
Source: Osteoporosis International - December 7, 2017 Category: Orthopaedics Source Type: research

Restrictive pulmonary dysfunction is associated with vertebral fractures and bone loss in elderly postmenopausal women
ConclusionsDiminished FVC was associated with prevalent vertebral fractures and decreased BMD in Japanese postmenopausal women without apparent pulmonary diseases. Mechanism of such association between pulmonary function and bone status remains to be determined. (Source: Osteoporosis International)
Source: Osteoporosis International - December 7, 2017 Category: Orthopaedics Source Type: research

Time to surgery after hip fracture across Canada by timing of admission
ConclusionsProvinces performed similarly with respect to recommended time for hip fracture surgery. The proportion of surgeries on admission day, and time required to complete 33% and 66% of surgeries, varied across provinces and by timing of admission. This may reflect different provincial approaches to providing access to hip fracture surgery. (Source: Osteoporosis International)
Source: Osteoporosis International - December 6, 2017 Category: Orthopaedics Source Type: research

Insights into the bisphosphonate holiday: a preliminary FTIRI study
ConclusionsDiscontinuation of alendronate for 5  years did not affect key FTIRI parameters, supporting the hypothesis that discontinuation would have little impact on bone composition. Modest differences were observed in three parameters that are not likely to affect bone mechanical properties. These preliminary data suggest that a 5-year BP hol iday is not harmful to bone composition. (Source: Osteoporosis International)
Source: Osteoporosis International - December 5, 2017 Category: Orthopaedics Source Type: research

Risk of venous thromboembolism among users of different anti-osteoporosis drugs: a population-based cohort analysis including over 200,000 participants from Spain and the UK
ConclusionsVTE risk during AO therapy did not differ by AOM drug use. Our data does not support an increased risk of VTE associated with strontium ranelate use in the community. (Source: Osteoporosis International)
Source: Osteoporosis International - December 3, 2017 Category: Orthopaedics Source Type: research

Early diagnosis of osteoporosis using radiogrammetry and texture analysis from hand and wrist radiographs in Indian population
ConclusionAn automated diagnostic technique for early diagnosis of onset of osteoporosis is developed using cortical radiogrammetric measurements and cancellous texture analysis of hand and wrist radiographs. The work shows that a combination of cortical and cancellous features improves the diagnostic ability and is a promising low cost tool for early diagnosis of increased risk of osteoporosis. (Source: Osteoporosis International)
Source: Osteoporosis International - December 3, 2017 Category: Orthopaedics Source Type: research

Characteristics, management, and outcome of primary hyperparathyroidism at a single clinical center from 2005 to 2016
This study presents the clinical and biochemical profiles of patients with PHPT between 2005 and 2016 at our center. Most PHPT patients in China show symptomatic features. The number of symptomatic and asymptomatic patients increased during that time, and the number of individuals with parathyroid carcinoma is now increasing.IntroductionOver the last decade, the prevalence of primary hyperparathyroidism (PHPT) has increased sharply, and the number of individuals with parathyroid cancer is still trending upward. Little is known about the clinical outlook of the disease over the last decade in China. The aim of this study wa...
Source: Osteoporosis International - December 3, 2017 Category: Orthopaedics Source Type: research

Comparison of muscle/lean mass measurement methods: correlation with functional and biochemical testing
AbstractSummaryDXA-measured lean mass is often used to assess muscle mass but has limitations. Thus, we compared DXA lean mass with two novel methods —bioelectric impedance spectroscopy and creatine (methyl-d3) dilution. The examined methodologies did not measure lean mass similarly and the correlation with muscle biomarkers/function varied.IntroductionMuscle function tests predict adverse health outcomes better than lean mass measurement. This may reflect limitations of current mass measurement methods. Newer approaches, e.g., bioelectric impedance spectroscopy (BIS) and creatine (methyl-d3) dilution (D3-C), may mor...
Source: Osteoporosis International - December 2, 2017 Category: Orthopaedics Source Type: research

A health economic simulation model for the clinical management of osteoporosis
ConclusionsThe analysis showed that better compliance to treatment guidelines is associated with better projected outcomes and cost-savings. From a cost-effectiveness perspective, there is also considerable room for investment to achieve these improvements in the management of osteoporosis. (Source: Osteoporosis International)
Source: Osteoporosis International - December 1, 2017 Category: Orthopaedics Source Type: research

Self-perception of fracture risk: what can it tell us?
ConclusionsThese results suggest that SPR captures some aspect of fracture risk not currently measured using conventional fracture prediction tools and is also associated with improved medication uptake. (Source: Osteoporosis International)
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

Discrepancy between bone density and bone material strength index in three siblings with Camurati-Engelmann disease
ConclusionDespite strikingly increased BMD and normal microarchitecture, BMSi is affected in patients with CE. Microindentation could be an appropriate tool for assessing bone fragility in these patients. Bone disease in this group of patients requires further study to better understand the underlying regulatory mechanisms and their alterations. (Source: Osteoporosis International)
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

Assessing impact of body mass index on risk of acute kidney injury and mortality in elderly patients undergoing hip fracture surgery
(Source: Osteoporosis International)
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

Management of oral bisphosphonates treatment by rheumatologists and determinants of therapeutic changes: a case-vignette-based study
ConclusionOur study shows that maintenance of oral bisphosphonate in postmenopausal women managed by rheumatologists is low; there are few determinants of these changes and more information on appropriate follow-up could help in patients ’ management. (Source: Osteoporosis International)
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

Increasing alkali supplementation decreases urinary nitrogen excretion when adjusted for same day nitrogen intake
ConclusionsUrinary N excretion expressed as ratio to same day N intake declined steadily with increasing doses of KHCO3 supplementation from low 1  mmol/kg/day to high 1.5 mmol/kg/day, suggesting a nitrogen-sparing effect. Compared to urinary N excretion alone, this ratio could be a more reasonable measure of muscle protein metabolism in large-scale long-term human studies.Trial registration:Clinicaltrials.gov NCT1475214 (Source: Osteoporosis International)
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

Effect of vitamin D3 on bone turnover markers in critical illness: post hoc analysis from the VITdAL-ICU study
AbstractSummaryIn this post hoc analysis of the VITdAL-ICU study, an RCT in critically ill adults with 25-hydroxyvitamin D levels ≤20 ng/ml, vitamin D3 did not have a significant effect on β-Crosslaps and osteocalcin.IntroductionObservational studies have shown accelerated bone loss in ICU survivors. A reversible contributor is vitamin D deficiency. In a post hoc analysis of the VITdAL-ICU study, we evaluated the effect of high-dose vitamin D3 on the bone turnover markers (BTM) β-Crosslaps (CTX) and osteocalcin (OC).MethodsThe VITdAL-ICU study was a randomized, double-blind, placebo-controlled trial in cr...
Source: Osteoporosis International - November 14, 2017 Category: Orthopaedics Source Type: research

CT-based evaluation of volumetric bone density in fragility fractures of the pelvis —a matched case-control analysis
AbstractSummaryThis matched case-control study compared the computed tomography (CT)-based regional bone density of patients with fragility fractures of the sacrum to a control without fracture. Patients with a sacral fracture demonstrated a significantly lower regional bone density of the sacrum, the sacral bone density not being correlated with the BMD by DXA of the spine.IntroductionThe aim of this study is to compare the computed tomography-based regional bone density measured by Hounsfield units (HUs) in patients with and without fragility fractures of the sacrum.MethodsPatients aged ≥ 50 years with a f...
Source: Osteoporosis International - November 13, 2017 Category: Orthopaedics Source Type: research

The effect of icariin on bone metabolism and its potential clinical application
In conclusion, icariin may represent a class of flavonoids with bone-promoting activity, which could be used as potential treatment of postmenopausal osteoporosis. (Source: Osteoporosis International)
Source: Osteoporosis International - November 6, 2017 Category: Orthopaedics Source Type: research

Osteoporosis and bone mineral density in patients with Wilson ’s disease: a systematic review and meta-analysis
AbstractThis systematic review aims to assess the occurrence and risks of osteopenia and osteoporosis in patientswith Wilson's disease (WD). A literature search was conducted utilizing EMBASE and MEDLINE frominception through April 2017. Studies assessing the occurrence or risk of osteopenia and/or osteoporosis inWD patients were included. Effect estimates from the individual study were extracted and combined usingrandom-effect, generic inverse variance method of DerSimonian and Laird. Of 754 studies, four studies with283 WD patients met the eligibility criteria and were included in the data analysis. The pooled prevalence...
Source: Osteoporosis International - November 6, 2017 Category: Orthopaedics Source Type: research

The impact of GI events on persistence and adherence to osteoporosis treatment: 3-, 6-, and 12-month findings in the MUSIC-OS study
ConclusionsThe occurrence of GI events was associated with a lower likelihood of patient adherence to and persistence with OP medication. (Source: Osteoporosis International)
Source: Osteoporosis International - November 6, 2017 Category: Orthopaedics Source Type: research

Characterization of trabecular bone microstructure in premenopausal women with distal radius fractures
ConclusionPremenopausal women with DRF have lower trabecular plate volume, number, thickness, and connectivity than CONT. Identification of young women with altered microarchitecture offers opportunities for lifestyle modifications to reduce fracture risk. (Source: Osteoporosis International)
Source: Osteoporosis International - November 3, 2017 Category: Orthopaedics Source Type: research

Dietary vitamin C intake and the risk of hip fracture: a dose-response meta-analysis
ConclusionsIn conclusion, the results of current meta-analysis strongly support that increasing dietary vitamin C intake can decrease the risk of hip fracture. In order to verify the association of vitamin C intake and hip fracture risk, further well-designed largely randomized controlled trials (RCTs) are needed. (Source: Osteoporosis International)
Source: Osteoporosis International - November 3, 2017 Category: Orthopaedics Source Type: research

Self-reported everyday physical activities in older people with osteoporotic vertebral fractures: a systematic review and meta-analysis
ConclusionStudies consistently show women with VF have reduced everyday activities, while much less research has been carried out in men. This information may be useful when designing interventions to improve physical function in people with osteoporotic VFs. (Source: Osteoporosis International)
Source: Osteoporosis International - November 3, 2017 Category: Orthopaedics Source Type: research

A meta-analysis of the association between body mass index and risk of vertebral fracture
AbstractSummaryWe conducted a meta-analysis of prospective studies to assess the association between BMI and incident vertebral fracture. We found that as body mass index (BMI) increases, the risk of vertebral fracture decreases in men, but not in women, suggesting possible gender differences in the relationship of BMI with risk of vertebral fracture.IntroductionRecent evidence suggests that the relationship between BMI and fracture risk may be site-specific. We conducted a systematic review and meta-analysis of prospective studies to investigate the association between BMI and risk of incident vertebral fracture.MethodsPu...
Source: Osteoporosis International - November 3, 2017 Category: Orthopaedics Source Type: research

Professor Judith Elizabeth Adams: Leading skeletal radiologist and expert in adult and paediatric bone densitometry
(Source: Osteoporosis International)
Source: Osteoporosis International - November 2, 2017 Category: Orthopaedics Source Type: research

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing
AbstractIn Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21). (Source: Osteoporosis International)
Source: Osteoporosis International - November 2, 2017 Category: Orthopaedics Source Type: research

Correction of vitamin D status by calcidiol: pharmacokinetic profile, safety, and biochemical effects on bone and mineral metabolism of daily and weekly dosage regimens
AbstractSummaryRationale: Calcidiol can be employed to correct vitamin D deficiency. Main results: Calcidiol administered at daily and weekly regimens over a period of 3  months was able to successfully raise 25-hydroxyvitamin D levels without altering other markers related to bone and mineral metabolism. Significance: Calcidiol supplementation is effective and safe.IntroductionThe correction of vitamin D status is necessary to maintain an optimal mineral and skeletal homeostasis. Despite cholecalciferol (vitamin D3) is the most commonly used drug for vitamin D supplementation, the more hydrophilic compound calcidiol ...
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Children and adolescents with cystic fibrosis display moderate bone microarchitecture abnormalities: data from high-resolution peripheral quantitative computed tomography
ConclusionIn our cohort of children and teenagers with good nutritional and lung function status, bone microstructure evaluated with HR-pQCT was not severely affected. Minimal microstructure abnormalities observed at the tibial level may be related to the cystic fibrosis transmembrane conductance regulator defect alone; the long-term consequences of such impairment will require further evaluation. (Source: Osteoporosis International)
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Increased levels of sodium chloride directly increase osteoclastic differentiation and resorption in mice and men
ConclusionsThe reported that enhanced bone resorption after high-sodium diets may not only be secondary to the urinary calcium loss but may also be a direct, cell-mediated effect on osteoclastic resorption. These findings allow us to suggest an explanation for the clinical findings independent of a PTH-mediated regulation. (Source: Osteoporosis International)
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

24-hour profile of serum sclerostin and its association with bone biomarkers in men
AbstractSummaryThe osteocyte ’s role in orchestrating diurnal variations in bone turnover markers (BTMs) is unclear. We identified no rhythm in serum sclerostin (osteocyte protein). These results suggest that serum sclerostin can be measured at any time of day and the osteocyte does not direct the rhythmicity of other BTMs in men.IntroductionThe osteocyte exerts important effects on bone remodeling, but its rhythmicity and effect on the rhythms of other bone cells are not fully characterized. The purpose of this study was to determine if serum sclerostin displays rhythmicity over a 24-h interval, similar to that of o...
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Systematic scoping review of patients ’ perceived needs of health services for osteoporosis
AbstractHealth service planners, administrators and providers need to understand the patients ’ perspective of health services related to osteoporosis to optimise health outcomes. The aims of this study were to systematically identify and review the literature regarding patients’ perceived health service needs relating to osteoporosis and osteopenia. A systematic scoping review was perfo rmed of publications in MEDLINE, EMBASE, CINAHL and PsycINFO (1990–2016). Descriptive data regarding study design and methodology were extracted and risk of bias assessed. Aggregates of patients’ perceived needs of ...
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Risk of low-energy fracture in type 2 diabetes patients: a meta-analysis of observational studies
ConclusionsPatients with T2DM had a greater risk of low-energy fracture especially of the hip, compared with that in non-diabetic subjects. However, since according to our funnel plot a publication bias may be present and due to study heterogeneity as well as the limited number of publications, the finding needs to be interpreted with caution. (Source: Osteoporosis International)
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

A comparison of electronic and manual fracture risk assessment tools in screening elderly male US veterans at risk for osteoporosis
ConclusionsOur study suggests that all FRATs tested perform similarly in identifying osteoporosis among elderly, primarily Caucasian, male veterans. If these electronic screening methods perform similarly for fracture outcomes, they could replace manual FRAX and thus improve efficiency in identifying individuals who should be sent for DXA scan. (Source: Osteoporosis International)
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Syndrome of inappropriate anti-diuresis induces volume-dependent hypercalciuria
ConclusionsOur results show that SIAD results in a volemic expansion tendency that is associated with a decrease in renal calcium reabsorption and thus hypercalciuria, whereas in the hypovolemic group, calciuria was not increased. Therefore, renal loss of calcium and bone demineralization in SIAD patients could be partly induced by volemic expansion. (Source: Osteoporosis International)
Source: Osteoporosis International - October 11, 2017 Category: Orthopaedics Source Type: research

Pro-inflammatory dietary pattern is associated with fractures in women: an eight-year longitudinal cohort study
ConclusionPro-inflammatory diet is associated with a higher incidence of fractures in women but not men. (Source: Osteoporosis International)
Source: Osteoporosis International - October 10, 2017 Category: Orthopaedics Source Type: research

Is drug-induced bone loss acceptable in premenopausal women? A practical fracture risk modeling exercise
ConclusionsFor clinicians and regulatory bodies to assess the consequence of drug-induced premenopausal bone loss, we propose an individualized approach considering both loss of BMD and TBS in concert with baseline bone status and the resultant effect on fracture risk in later life using the assumption that such losses are irreversible. (Source: Osteoporosis International)
Source: Osteoporosis International - October 10, 2017 Category: Orthopaedics Source Type: research

Kyphosis and incident falls among community-dwelling older adults
ConclusionsEach kyphosis measure was independently associated with incident falls. Findings were inconsistent for injurious falls; the blocks measure suggested the strongest association. If these findings are replicated, the blocks measure could be incorporated into office visits as a quick and efficient tool to identify patients at increased fall risk. (Source: Osteoporosis International)
Source: Osteoporosis International - October 10, 2017 Category: Orthopaedics Source Type: research