Liver graft rejection following immune checkpoint inhibitors treatment: a review
AbstractImmune checkpoint inhibitors (ICIs) have demonstrated remarkable efficacy in a variety of solid tumors; nonetheless, they have not been well investigated and are still recognized as a relative contraindication for patients with a liver transplantation (LT) history, since ICIs treatment might potentially lead to graft rejection. The program death-1 (PD-1) and the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) pathways are implicated in the tolerance of transplanted organ, as well as blockade of the pathways, which contribute to eliminating tumors and may inadvertently lead to peripheral transplant rejection. C...
Source: Medical Oncology - October 11, 2019 Category: Cancer & Oncology Source Type: research

nab -Paclitaxel-based induction chemotherapy followed by cisplatin and radiation therapy for human papillomavirus-unrelated head and neck squamous-cell carcinoma
AbstractIn patients with locally advanced human papillomavirus (HPV)-unrelated head and neck squamous-cell carcinoma (HNSCC), cisplatin and radiation therapy (CisRT) resulted in a local –regional recurrence (LRR) rate of 35%, progression-free survival (PFS) of 49%, and overall survival (OS) of 60%. We, and others, showed thatnab-paclitaxel is an active agent in metastatic and locally advanced HNSCC. The aim of this report was to assess the efficacy ofnab-paclitaxel-based induction chemotherapy and CisRT in HPV-unrelated HNSCC. We performed a retrospective single-institution analysis of patients treated withnab-paclit...
Source: Medical Oncology - October 8, 2019 Category: Cancer & Oncology Source Type: research

SOX4 is activated by C-MYC in prostate cancer
AbstractAlthough MYC proto-oncogene (C-MYC) amplification has been consistently reported to be a potential marker for prostate cancer (PCa) progression and prognosis, the clinicopathological and prognostic significance of C-MYC protein expression remains controversial. Overexpression of SOX4 has been shown to play important roles in multiple cancers including PCa. However, the link between these two critical genetic aberrations is unclear. In the current study, we showed that C-MYC was overexpressed in 16.2% (17/105) of Chinese patients with localized PCa. Overexpression of C-MYC was significantly associated with high Glea...
Source: Medical Oncology - September 27, 2019 Category: Cancer & Oncology Source Type: research

Mechanism of VIPR1 gene regulating human lung adenocarcinoma H1299 cells
AbstractThe vasoactive intestinal peptide receptor-1(VIPR1) has prominent growth effects on a number of common neoplasms. However, there were contradictions in the effect cross different cancers. We aimed to explore the effect of VIPR1 overexpression on a human lung adenocarcinoma cell line H1299. GEO dataset was used to screen differentially expressed genes in lung adenocarcinoma tissues. The expression of VIPR1 mRNA was determined in the cancer Genome Atlas (TCGA). Immunohistochemical analysis was performed to determine VIPR1 protein expression in lung adenocarcinoma and corresponding adjacent tissues (n = ...
Source: Medical Oncology - September 27, 2019 Category: Cancer & Oncology Source Type: research

Outcomes of hypercalcemia of malignancy in patients with solid cancer: a national inpatient analysis
AbstractHypercalcemia of malignancy (HCM) is present in one-third of cancer patients and is associated with a significant mortality risk of 50% within 1  month of diagnosis. We aimed to study the impact and outcomes of HCM in hospitalized patients with solid cancer. We analyzed data captured in the National Inpatient Sample database of the Agency of Healthcare Research and Quality. The study included all hospitalizations in adult solid cancer patie nts between January 2012 and September 2015 with hypercalcemia. All encounters associated with HCM were identified using the ICD-9 code (275.42) for hypercalcemia. Encounte...
Source: Medical Oncology - September 16, 2019 Category: Cancer & Oncology Source Type: research

Multicenter prospective study validating the efficacy of a quantitative assessment tool for frailty in patients with urological cancers
AbstractWe prospectively validate the efficacy of the frailty discriminant score (FDS) in individuals with urological cancers, as there has been growing importance in evaluating frailty in clinical practice. A prospective, multicenter study was conducted from February 2017 to April 2019. We enrolled 258 patients with urological cancers and 301 community-dwelling participants who were assessed for frailty. Frailty was assessed using FDS that includes ten items, such as physical, mental, and blood biochemical tests. The primary outcome was the non-inferiority (margin 5%) of FDS in discriminating patients with urological canc...
Source: Medical Oncology - September 13, 2019 Category: Cancer & Oncology Source Type: research

Impact of circulating tumour cells on survival of eribulin-treated patients with metastatic breast cancer
AbstractSeveral clinical studies have examined circulating tumour cells (CTCs). However, the application of CTCs as a predictive/prognostic marker for breast cancer patients has yet to be established, particularly the selection of suitable markers for detecting CTCs. We recently investigated CTCs, including mesenchymal status, from metastatic breast cancer patients who had received eribulin-based treatment. We found that assessment of both mesenchymal and epithelial CTCs might be important for predicting eribulin responsiveness. In the current study, we followed up the outcomes of these patients after eribulin treatment an...
Source: Medical Oncology - September 13, 2019 Category: Cancer & Oncology Source Type: research

Circular RNA expression and circPTPRM promotes proliferation and migration in hepatocellular carcinoma
This study explored circRNA expression and the function of circPTPRM in HCC. RNA sequencing  (RNA-seq) was performed on 3 randomly selected pairs of HCC tissues and their corresponding adjacent non-tumor tissues. Three differentially expressed circRNAs, circPTPRM, circSMAD2 and circPTBP3 were selected and verified by real-time quantitative reverse transcription-polymerase chain reactions in 30 pairs of tissue samples, In vitro cultured hepatoma cells, and normal liver cells. Clinical data analysis was performed to select target circRNAs. Anti-target circRNA siRNAs were transfected into hepatoma cell lines, and the bio...
Source: Medical Oncology - September 7, 2019 Category: Cancer & Oncology Source Type: research

Comparison of conventional versus liposomal irinotecan in combination with fluorouracil for advanced pancreatic cancer: a single-institution experience
AbstractThe majority of pancreatic cancers are diagnosed at an advanced stage, when surgical options are limited and treatment relies on systemic chemotherapy. In the NAPOLI-1 trial, liposomal irinotecan in combination with fluorouracil (nal-iri/5FU) was shown to improve overall survival when compared to fluorouracil alone for metastatic pancreatic cancer. Other retrospective studies have shown the combination of fluorouracil and conventional irinotecan (FOLFIRI) to be a viable option, though no randomized trials have compared nal-iri/5FU to FOLFIRI. The purpose of this single-center, retrospective, cohort study was to det...
Source: Medical Oncology - September 7, 2019 Category: Cancer & Oncology Source Type: research

Circulating CD16+CD56+ nature killer cells indicate the prognosis of colorectal cancer after initial chemotherapy
AbstractAs the prognosis of colorectal cancer (CRC) does not always coincide with the pathology and/or surgical findings, a reliable noninvasive prediction tool for the prognosis of CRC is needed. Patients admitted for initial treatment of CRC between January 1, 2015 and December 31, 2015 were retrieved and reviewed. Records of circulating CD16+  CD56+ natural killer (NK) cells were analyzed before and after the initial chemotherapy of FOLFOX plan. Patients were followed up until June 30, 2019. One hundred and twenty-four cases after the FOLFOX chemotherapy were enrolled into this study. There were no signifi...
Source: Medical Oncology - September 6, 2019 Category: Cancer & Oncology Source Type: research

Outcomes in patients  ≥ 80 years with a diagnosis of a hepatopancreaticobiliary (HPB) malignancy
This study assessed patient outcomes in those  
Source: Medical Oncology - September 6, 2019 Category: Cancer & Oncology Source Type: research

Nab-paclitaxel plus gemcitabine as first line therapy in metastatic pancreatic cancer patients relapsed after gemcitabine adjuvant treatment
AbstractNab-paclitaxel plus gemcitabine (Nab-Gem) represents one of the standard regimen for first-line treatment of metastatic pancreatic adenocarcinoma (mPDAC). However, few data are available in mPDAC relapsed after gemcitabine as adjuvant treatment. Our study aims to evaluate the efficacy and feasibility of Nab-Gem as first-line treatment for mPDAC patients previously treated with adjuvant treatment. We retrospectively analyzed the safety and efficacy data of 36 patients, who received first-line Nab-Gem after gemcitabine as adjuvant treatment. All patients received gemcitabine after radical surgery. Median disease-free...
Source: Medical Oncology - August 23, 2019 Category: Cancer & Oncology Source Type: research

EMT-related protein expression in polyploid giant cancer cells and their daughter cells with different passages after triptolide treatment
AbstractOur previous work has demonstrated that paclitaxel can induce the formation of polyploid giant cancer cells (PGCCs) and inhibit tumor growth by reprogramming ovarian cancer epithelial cells to a benign fibroblastic state via epithelial –mesenchymal transition. Here, triptolide (TPL) was used to treat the breast and ovarian cancer lines. The morphologic characteristics and EMT-related protein expression were studied in different generation of cancer cells after TPL treatment. When BT-549 and HEY cells reached 80–90% confluence, TPL was added to BT-549 for 48 h and HEY for 9 h at a concentration...
Source: Medical Oncology - August 12, 2019 Category: Cancer & Oncology Source Type: research

Metronomic chemotherapy with cyclophosphamide plus low dose of corticosteroids in advanced castration-resistant prostate cancer across the era of taxanes and new hormonal drugs
AbstractThe aim of our study is to investigate the efficacy of metronomic cyclophosphamide plus low dose of corticosteroids in advanced or metastatic castration-resistant prostate cancer (CRPC) before, between, and after standard chemotherapy, such as docetaxel and cabazitaxel, and new hormonal treatments, such as abiraterone and enzalutamide. A retrospective analysis was performed on 37 patients. Cyclophosphamide was given orally 50  mg per day together with low dose of corticosteroids, namely dexametasone orally 1 mg per day or prednisone 10 mg per day. Seventeen patients (51%) showed a PSA decline≥&thi...
Source: Medical Oncology - August 9, 2019 Category: Cancer & Oncology Source Type: research

MicroRNA expression profiling provides novel insights into immune-related pathways involved in gastric cancer
AbstractGastric cancer is one of the most common cancers, and an increasing number of studies have found that microRNAs (miRNAs) play essential roles in gastric cancer progression; however, the roles of specific miRNAs involved in the immune response to this disease remain unclear. We compared the miRNA expression in tissues from primary gastric cancer patients and healthy controls to find miRNAs dysregulated in gastric cancer and used bioinformatics tools to determine potential roles of these miRNAs in the immune system. We evaluated 25 primary gastric cancer tissues and five healthy gastric tissues. Quantitative real-tim...
Source: Medical Oncology - August 9, 2019 Category: Cancer & Oncology Source Type: research

Examination of clonal evolution in chronic lymphocytic leukemia
AbstractChronic lymphocytic leukemia (CLL) is one of the most frequent lymphoproliferative diseases. CLL is characterized by unusual heterogeneity, which probably reflects its biological and genetic lack of homogeneity. Clonal chromosome aberrations belong to the most important prognostic and predictive factors in CLL. This research was aimed at observing clonal evolution in CLL at the chromosomal level, and assessing its clinical significance in relation to selected prognostic factors. The study involved 72 untreated patients with CLL. The preliminary investigations using cytogenetic banding analysis (CBA) and FISH were p...
Source: Medical Oncology - August 2, 2019 Category: Cancer & Oncology Source Type: research

ADA activity is decreased in lymphocytes from patients with advanced stage of lung cancer
AbstractCigarette smoking is directly associated with lung cancer. Non-small cell lung carcinoma (NSCLC) represents approximately 80% from all types of lung cancer. This latter is hard to diagnose and to treat due to the lack of symptoms in early stages of the disease. The aim of this study was to  evaluate ADA activity and the expression of P2X7, A1, and A2A receptors and in lymphocytes. In addition, the profile of pro-inflammatory and anti-inflammatory cytokines serum levels of patients with lung cancer in advanced stage was evaluated. Patients (n = 13) previously treated for lung cancer at stage IV (U...
Source: Medical Oncology - August 2, 2019 Category: Cancer & Oncology Source Type: research

A novel alkylating deacetylase inhibitor molecule EDO-S101 in combination with cytarabine synergistically enhances apoptosis of acute myeloid leukemia cells
In this study, we investigated the effect of EDO-S101 in combination with cytarabine in treating AML cells. The synergic activity against AML was identified by remarkable reduction of cell viability, significant apoptosis enhancement and the upregulation of the cleaved PARP, Casepase-3 and -7 proteins compared with monotherapy. To explain the drivers, we detected the DNA damage pathway including DNA double-strand breaks marker γ-H2AX and DNA damage checkpoint proteins, which was supposed to be responsible for the enhanced apoptosis activity. In summary, our data demonstrated that EDO-S101 in combination with cytarabi...
Source: Medical Oncology - August 1, 2019 Category: Cancer & Oncology Source Type: research

Programmed death-1 receptor (PD-1) and PD-ligand-1 (PD-L1) expression in non-small cell lung cancer and the immune-suppressive effect of anaerobic glycolysis
AbstractThe microenvironment of a tumor may regulate the anti-tumor immune response. Intratumoral acidosis and hypoxia may suppress lymphocyte proliferation and migration, and this may have important implications in modern immunotherapy. The expression of PD-L1 by cancer cells and of PD-1 by tumor infiltrating lymphocytes (TILs) was assessed in tissue specimens from 98 operable NSCLC patients. Their prognostic role and their association with makers of glycolysis and anaerobic metabolism were assessed. Strong cytoplasmic/membrane PD-L1 expression was noted in 45/98 cases. Intense presence of TILs was noted in 42/98 cases (h...
Source: Medical Oncology - July 24, 2019 Category: Cancer & Oncology Source Type: research

MPC-1 expression in myeloma cells is associated with the efficacy of bortezomib therapy
In this study, we analyzed the association between immunophenotyping on myeloma cells and the clinical outcomes of patients who received bortezomib-based regimens as first-line therapy. Immunophenotypic analysis before bortezomib therapy was performed by flow cytometry, and whether the immunophenotyping results influenced the clinical outcomes of the patients was investigated. Seventy-four newly diagnosed patients with MM were included in this study. We found that the expression of MPC-1 significantly predicted the time to next therapy (TNT), with a longer TNT in the MPC-1 positive group (p  =  0.005), wherea...
Source: Medical Oncology - July 24, 2019 Category: Cancer & Oncology Source Type: research

Clinical and morphologic review of 60 hereditary renal tumors from 30 hereditary renal cell carcinoma syndrome patients: lessons from a contemporary single institution series
AbstractHereditary renal cell carcinoma syndromes (HRCCS) are characterized by the presence of pathogenic germline variants that predispose patients to renal cell carcinomas as well as additional extra-renal manifestations. The importance of identifying HRCCS patients cannot be overemphasized, as patients and their families can begin surveillance for syndrome-associated manifestations once identified. The present study is a retrospective clinical and morphologic review of 60 hereditary renal tumors from 30 HRCCS patients treated at our institution with either Von Hippel-Lindau disease (VHL), Birt-Hogg-Dub é syndrome...
Source: Medical Oncology - July 22, 2019 Category: Cancer & Oncology Source Type: research

Identification of important invasion and proliferation related genes in adrenocortical carcinoma
In conclusion, DEGs and hub genes diagnosed in this study may deepen our understanding of molecular mechanisms underlying the progression of ACC, and pr ovide important targets for diagnosis and treatment of ACC. (Source: Medical Oncology)
Source: Medical Oncology - July 18, 2019 Category: Cancer & Oncology Source Type: research

Anti-cancer drugs-induced arterial injury: risk stratification, prevention, and treatment
AbstractVascular side effects of standard chemotherapeutic drugs and novel anti-tumor agents complicate treatment cycles, increase non-cancer-related mortality rates, and decrease the quality of life in cancer survivors. Arterial thromboembolic events (ATEE) are associated with most anti-cancer medications. Previous articles have reported a variety of vascular events including ST-segment elevation myocardial infarction as one of the most severe acute arterial attacks. Cardiologists should play an early role in identifying those at high risk for vascular complications and tailor anti-thrombotic therapies in keeping with thr...
Source: Medical Oncology - July 10, 2019 Category: Cancer & Oncology Source Type: research

Functional coding and non-coding variants in human BRCA1 gene and their use in genetic screening
AbstractBRCA1 is involved in double-strand DNA damage repair pathways, and mutations in the gene are associated with hereditary breast and ovarian cancers. With great help of the development of high-throughput DNA sequencing techniques numerous single-nucleotide polymorphisms (SNPs) and insertion deletion (Indel) mutations are detected on both coding and non-coding/regulatory regions of theBRCA1. Mutations may cause pathogenic or benign changes on the protein function or affect its expression. In the last decade, use of genetic screening tests to detect mutations on such genes has become greatly popular. However, it is ver...
Source: Medical Oncology - July 3, 2019 Category: Cancer & Oncology Source Type: research

A study of mechanistic mapping of novel SNPs to male breast cancer
AbstractAlterations inBRCA2,PALB2,CHEK2, andp53 genes have been identified for their association with male breast cancer in various studies. The incidence of male breast cancer in India is consistent with its global rate. The present study was carried out with an aim to evaluate the genetic alterations in male breast cancer patients from Malwa region of Punjab, India. Four male breast cancer patients belonging to different families were recruited from Guru Gobind Singh Medical College and Hospital, Faridkot, India. A total of 51 genes reported with implications in the pathogenesis of breast cancer were screened using next ...
Source: Medical Oncology - June 15, 2019 Category: Cancer & Oncology Source Type: research

Hypofractionated radiotherapy combined with cetuximab in vulnerable elderly patients with locally advanced head and neck squamous cell carcinoma
This study was designed to evaluate the objective response after hypofractionated radiotherapy (HFRT) combined with cetuximab (HFBRT) in vulnerable elderly patients with locally advanced head and neck squamous cell carcinoma (HNSCC). Vulnerable elderly patients with histologically proven HNSCC received HFRT (total dose 60  Gy, 3 Gy/fraction) with concurrent cetuximab (250 mg/m2 with a loading dose of 400  mg/m2 1  week before HFRT). Elderly patients were categorized as vulnerable based on mini-cog test and adult comorbidity evaluation-27 score. All patients completed the programmed HFRT and two pat...
Source: Medical Oncology - June 12, 2019 Category: Cancer & Oncology Source Type: research

Recurrent prostate cancer after radical prostatectomy: restaging performance of 18F-choline hybrid PET/MRI
AbstractTo evaluate the diagnostic performance of a whole-body 18F-choline (FCH) hybrid PET/MRI for prostate cancer patients at biochemical relapse after radical prostatectomy (RP) compared to pelvic multiparametric MRI (mpMRI), one of the standard imaging modality for this patient population. From 2010 to 2016, 58 whole-body FCH PET/MRI studies with mpMRI acquisitions were performed in 53 prostate cancer patients relapsing after curative RP. Median PSA and PSA doubling time (PSA DT) at PET study were 1.5  ng/ml and 6.5 months, respectively. The overall positivity rate of FCH PET/MRI was 58.6% (n = ...
Source: Medical Oncology - June 12, 2019 Category: Cancer & Oncology Source Type: research

Vitamin D supplementation and colorectal cancer prognosis
(Source: Medical Oncology)
Source: Medical Oncology - June 12, 2019 Category: Cancer & Oncology Source Type: research

Forced expression of NR4A3 induced the differentiation of human neuroblastoma-derived NB1 cells
AbstractNuclear receptor subfamily 4, group A, member 3 (NR4A3) is a member of the NR4A subgroup of orphan nuclear receptors, implicated in the regulation of diverse biological functions, including metabolism, angiogenesis, inflammation, cell proliferation, and apoptosis. Although many reports have suggested the involvement of NR4A3 in the development and/or progression of tumors, its role varies among tumor types. Previously, we reported that DNA hypomethylation at NR4A3 exon 3 is associated with lower survival rate of neuroblastoma (NB) patients. As hypomethylation of this region results in reduced expression of NR4A3, o...
Source: Medical Oncology - June 10, 2019 Category: Cancer & Oncology Source Type: research

Mortality rates and prognostic factors in patients with malignant salivary tumors
We examined the role of various salivary tumorigenic, clinical and therapeutic features in a cohort of 101 patients diagnosed and treated for primary malignant salivary tumors. These include histo-pathological diagnosis, stage, grade and T, N, M values as well as the existence of perineural invasion and extra-parenchymal spread. We also identified the salivary gland involved, the sub-compartment specific location of the tumor and the therapy administered. All these were related to mortality. Of the 101 patients examined, 79 survived and 22 died due to the disease. Tumor staging, distant metastasis and perineural invasion w...
Source: Medical Oncology - June 5, 2019 Category: Cancer & Oncology Source Type: research

The role of radiotherapy in epithelial ovarian cancer: a literature overview
AbstractOvarian cancer (OC) accounts for 3% of all cancer in women and for 5% of all cancer-related deaths. Epithelial Ovarian Cancer (EOC) is a radiosensitive malignancy with a poor prognosis. In the pre-chemotherapy era, radiation therapy (RT) delivered to the abdominopelvic region (whole abdominal irradiation, WAI) has historically played a role in the adjuvant and consolidation setting. Specific cluster of patients with early-stage disease and definite histologies may take advantage of RT. Platinum-based chemotherapy (CT) has replaced RT and plays a major role in most of the clinical settings. Radiation Therapy for pal...
Source: Medical Oncology - June 4, 2019 Category: Cancer & Oncology Source Type: research

High total bilirubin level is a significant risk factor for severe neutropenia in patients receiving irinotecan-based chemotherapy
AbstractIrinotecan is effective for the treatment of metastatic colorectal cancer (mCRC) and advanced pancreatic cancer (aPC). However, these treatments are often limited due to the incidence of severe neutropenia. We identified risk factors for severe neutropenia in patients with mCRC or aPC, receiving irinotecan-based chemotherapy regimens. The study selected 104 patients (mCRC: 53 and aPC: 51) who received irinotecan-based chemotherapy between January 2014 and May 2018 and who were included in the present study. The initial dose of irinotecan was 150  mg/m2 in all patients, and patients with a lower initial dose of...
Source: Medical Oncology - June 3, 2019 Category: Cancer & Oncology Source Type: research

Expression of cellular apoptosis susceptibility (CAS) in the human testis and testicular germ cell tumors
AbstractTesticular germ cell tumors are the most frequent malignancies found in men between 15 and 44  years old. Although cellular apoptosis susceptibility (CAS) was demonstrated to be upregulated in breast cancer and colon cancer, the expression of CAS in the human testis and testicular germ cell tumors remained elusive. In the present study, CAS-positive signals were detected in the normal testi cular tissues, cancer adjacent normal testicular tissues, seminoma, yolk sac tumor, and teratoma. Interestingly, the expression level of CAS in testicular germ cell tumors (TGCTs) (but not seminoma) was significantly lower ...
Source: Medical Oncology - May 29, 2019 Category: Cancer & Oncology Source Type: research

Effectiveness of a genetic test panel designed for gynecological cancer: an exploratory study
AbstractTo increase diagnostic efficiency and cost-effectiveness, we performed an exploratory genetic test using a newly designed panel containing 28 actionable and druggable genes, alterations in which are frequently reported in gynecological cancers (TANRE-G,Targeted variantsANalysisRElated toGynecological cancers). Samples consisted of the formalin-fixed, paraffin-embedded tissue of endometrial (4 cases), cervical (3 cases), and ovarian (4 cases) carcinomas. The sequencing procedure was performed using Ion PGM in our institute with related sequencing kits, and data were analyzed using ClinVar. The present system achieve...
Source: Medical Oncology - May 29, 2019 Category: Cancer & Oncology Source Type: research

Clinical significance of soluble forms of immune checkpoint molecules in advanced esophageal cancer
AbstractImmune checkpoint molecules are expressed on cancer cells and regulate tumor immunity by binding to ligands on immune cells. Although soluble forms of immune checkpoint molecules have been detected in the blood of patients with some types of tumors, their roles have not been fully elucidated. Soluble PD-L1, PD-1, CD155, LAG3, and CD226 (sPD-L1, sPD-1, sCD155, sLAG3, and sCD226, respectively) were measured in the sera of 47 patients with advanced esophageal cancer and compared with those of 24 control subjects. Pretreatment levels of sPD-1 and sCD155 were significantly higher in the patients with cancer than in the ...
Source: Medical Oncology - May 27, 2019 Category: Cancer & Oncology Source Type: research

Bone marrow examination in patients with Ewing sarcoma/peripheral primitive neuroectodermal tumor without metastasis based on 18 F-fluorodeoxyglucose positron emission tomography/computed tomography
AbstractEwing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET) is an aggressive bone tumor. Bone marrow aspiration and biopsy (BMAB) has been recognized as the gold standard for assessing bone marrow status. While the latest guideline suggests the need to omit bone marrow aspiration in patients with no findings on18F-fluorodeoxyglucose positron emission tomography (18F-FDG PET) based on one retrospective report, there is no study using18F-FDG PET/computed tomography (CT). We retrospectively reviewed 26 consecutive, previously untreated, ES/PNET patients. We compare the results of bone marrow aspiration and biop...
Source: Medical Oncology - May 18, 2019 Category: Cancer & Oncology Source Type: research

Rhabdomyosarcoma in adults: analysis of treatment modalities in a prospective single-center series
This study reinforced the idea that adherence to the principles of pediatric protocols, improves adult RMS outcomes. However, treating adults with pediatric-type strategy is not enough to achieve the results obta ined in children. Issues in compliance and a more aggressive biology of adult RMS might have a role in the different outcome according to age. Improving the collaboration between pediatric and adult oncologists in promoting specific clinical and biological research is crucial to improve the outcome for this patient population. (Source: Medical Oncology)
Source: Medical Oncology - May 18, 2019 Category: Cancer & Oncology Source Type: research

Real-world study of afatinib in first-line or re-challenge settings for patients with EGFR mutant non-small cell lung cancer
This study evaluated clinical outcomes of afatinib in real-world practice. Medical records of patients who received afatinib for advanced EGFR-mutant NSCLC were retrospectively reviewed. In total, 128 patients were analyzed. Seventy-six patients received afatinib as the first-line setting and 52 as the re-challenge setting (i.e., after failure of prior first-generation TKI). There was no difference in patient characteristics, such as age, sex, and PS, between the first-line and the re-challenge settings. In the first-line setting, the median progression-free survival (PFS) was 17.8 months (95% confidence interval [CI]...
Source: Medical Oncology - May 14, 2019 Category: Cancer & Oncology Source Type: research

Identification of candidate diagnostic and prognostic biomarkers for human prostate cancer: RPL22L1 and RPS21
This study was designed to investigate the potential of Ribosomal Protein L22-like1 (RPL22L1) and Ribosomal Protein S21 (RPS21) as diagnostic and prognostic biomarkers for PCa. First, RPL22L1 and RPS21 were screened as the key molecular of PCa by bioinformatics analysis. Subsequently, the prostate tissue samples were stained for antibodies against RPL22L1 and RPS21. The unbiased signal quantification was performed by ImageJ software, and the results showed that the expression of RPL22L1 and RPS21 exhibited significant differences between the PCa tissues and the normal prostate tissues. Receiver-operating characteristics (R...
Source: Medical Oncology - May 14, 2019 Category: Cancer & Oncology Source Type: research

Influence of ABCB1 polymorphisms on the pharmacokinetics and toxicity of lenalidomide in patients with multiple myeloma
AbstractIndividual diversity in plasma concentrations of lenalidomide occurs despite dosage modifications based on creatinine clearance (CCr), which can lead to unexpected toxicity. We have previously identified a cutoff value of area under the concentration –time curve (AUC0 –24) for lenalidomide to avoid severe toxicity. Here, we investigated the association betweenABCB1 polymorphisms and pharmacokinetics of lenalidomide in patients with multiple myeloma (MM) treated with lenalidomide and dexamethasone. Plasma concentrations of lenalidomide were analyzed using liquid chromatography –tandem mass spectrom...
Source: Medical Oncology - May 14, 2019 Category: Cancer & Oncology Source Type: research

Performance of a new system using a one-step nucleic acid amplification assay for detecting lymph node metastases in breast cancer
This study was aimed at evaluating clinical performance of the new system by comparing it with performance of histopathological analysis and a conventional OSNA system. A total of 150 lymph nodes in 63 breast cancer patients (T1–3) who underwent sentinel lymph node biopsy or axillary lymph node dissection were examined intraoperatively with the new OSNA system, the conventional system, and histopathological analysis. In comparison with histopathological analysis, sensitivity, specificity, and concordance rate of the new system were 93.9, 98 .8, and 96.7%, respectively. In comparison with the conventional system, simi...
Source: Medical Oncology - May 6, 2019 Category: Cancer & Oncology Source Type: research

Subgroup analysis of efficacy and safety of orantinib in combination with TACE in Japanese HCC patients in a randomized phase III trial (ORIENTAL)
AbstractA randomized, phase III trial of orantinib in combination with transcatheter arterial chemoembolization (TACE) did not prolong overall survival (OS) over placebo (ORIENTAL study). A subgroup analysis was conducted to evaluate the efficacy and safety of orantinib in Japanese patients enrolled in the ORIENTAL study. The data of Japanese patients from this study were analyzed. The overall survival (OS), time to progression (TTP), and time to TACE failure (TTTF) were compared between orantinib and placebo arms using stratified log-rank test. Since TTTF in patients with Barcelona Clinic Liver Cancer stage B (BCLC-B) sho...
Source: Medical Oncology - May 3, 2019 Category: Cancer & Oncology Source Type: research

Correction to: Expression of Concern: Knockdown of eIF3d inhibits cell proliferation through G2/M phase arrest in non-small cell lung cancer
The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as"TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT". (Source: Medical Oncology)
Source: Medical Oncology - May 3, 2019 Category: Cancer & Oncology Source Type: research

N-Glycosylation in progression of skin cancer
AbstractSkin cancer can be classified as cutaneous malignant melanoma, basal cell carcinoma, and squamous cell carcinoma. Due to the high level of morbidity and mortality, skin cancer has become a global public health issue worldwide while the pathogenesis of skin cancer is still unclear. It is necessary to further identify the pathogenesis of skin cancer and find candidate targets to diagnose and treat skin cancer. A variety of factors are known to be associated with skin cancer including N-glycosylation, which partly explained the malignant behaviors of skin cancer. In this review, we retrieved databases such as PubMed a...
Source: Medical Oncology - April 29, 2019 Category: Cancer & Oncology Source Type: research

Intra- and inter-observer variability in breast tumour bed contouring and the controversial role of surgical clips
AbstractThe purpose of this study was to evaluate whether the visualization of surgical clips (SCs) on the same set of planning computed tomography (CT) of breast cancer (BC) patients influences agreement on tumour bed (TB) delineation. Planning CT (CTorig) of 47 BC patients with SCs to visualize the TB was processed in order to blur SCs and create a virtual CT (CTmod). Four radiation oncologists (ROs, 2 juniors and 2 seniors) contoured TB on both the CT sets. Centre of mass distance (CMD), percentage overlap as Dice similarity coefficient (DSC), surface distance as average Hausdorff distance (AHD) and TB volume size were ...
Source: Medical Oncology - April 29, 2019 Category: Cancer & Oncology Source Type: research

Tumor expression and usefulness as a biomarker of programmed death ligand 1 in advanced non-small cell lung cancer patients with preexisting interstitial lung disease
AbstractIn non-small cell lung cancer (NSCLC) patients, the expression of tumor programmed death ligand 1 (PD-L1) is an important parameter for deciding the timing of the use of anti-programmed cell death 1 (PD-1) antibody. There has been increasing concern over the benefit of anti-PD-1 antibody in high-risk patients, such as those with preexisting interstitial lung disease (ILD). However, the status and value of PD-L1 as a predictive biomarker and the efficacy of anti-PD-1 antibody in NSCLC patients with preexisting ILD remains uncertain. We retrospectively reviewed the medical records of advanced/recurrent NSCLC patients...
Source: Medical Oncology - April 27, 2019 Category: Cancer & Oncology Source Type: research

Postmastectomy radiation therapy using VMAT technique for breast cancer patients with expander reconstruction
AbstractPostmastectomy radiotherapy (PMRT) following immediate breast reconstruction is increasingly adopted in the management of breast cancer patients. We retrospectively evaluate the complication rates of PMRT using VMAT technique to immediate tissue expander-based reconstructions and the possible impact of tissue expander volume on radiotherapy planning. We reviewed the data of patients who underwent immediate expander breast reconstruction and received PMRT with VMAT (50  Gy in 25 fractions) on the reconstructed breast and axillary levels III–IV. Neoadjuvant or adjuvant systemic therapy was administered in ...
Source: Medical Oncology - April 25, 2019 Category: Cancer & Oncology Source Type: research

Timing of treatment in small-cell lung cancer
AbstractSmall-cell lung cancer (SCLC) is an aggressive disease with poor survival and rapid doubling time. Current practice is to treat SCLC as soon as possible but evidence on appropriate timing of treatment from diagnosis  (TTD) is lacking. This is a retrospective analysis of SCLC patients from the 2012 to 2015 Kentucky Cancer Registry. Data collected included age at diagnosis, stage, gender, race, insurance and treatment. Factors and survival associated with TTD were identified with logistic regression analyses and Cox proportional hazards models. Among the 2992 SCLC patients, 2371 (79%) of SCLC patients were treat...
Source: Medical Oncology - April 25, 2019 Category: Cancer & Oncology Source Type: research

Multicenter open-label randomized phase II study of second-line panitumumab and irinotecan with or without fluoropyrimidines in patients with KRAS wild-type metastatic colorectal cancer (PACIFIC study)
In conclusion, this study failed to prove the safety and efficacy of irinotecan and panitumumab treatment due to insufficient patient accrual. Although LDH and its isozymes changed after initiation of treatment, their ability to predict the tumor response may not surpass that of carcinoembryonic antigen levels.The University Hospital Medical Information Network Clinical Trial Registry: UMIN000007658. (Source: Medical Oncology)
Source: Medical Oncology - April 24, 2019 Category: Cancer & Oncology Source Type: research

Interaction between phytotherapy and oral anticancer agents: prospective study and literature review
AbstractCancer is becoming more prevalent in elderly patient. Due to polypharmacy, older adults with cancer are predisposed to drug-drug interactions. There is also an increasing interest in the use of complementary and alternative medicine (CAM). Thirty to seventy percent of patients with cancer have used CAM. Through pharmaceutical counseling sessions, we can provide advices on herb –drug interactions (HDI). All the patients seen in pharmaceutical counseling sessions were prospectively included. Information was collected during these sessions: prescribed medication (oral anticancer agents (OAA) and other drugs), CA...
Source: Medical Oncology - April 16, 2019 Category: Cancer & Oncology Source Type: research